ID: 921994680

View in Genome Browser
Species Human (GRCh38)
Location 1:221405309-221405331
Sequence GAGGATTAAAAAGGAAATAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921994680_921994682 -8 Left 921994680 1:221405309-221405331 CCTGTATTTCCTTTTTAATCCTC No data
Right 921994682 1:221405324-221405346 TAATCCTCCTTGTTAAATGCTGG No data
921994680_921994685 13 Left 921994680 1:221405309-221405331 CCTGTATTTCCTTTTTAATCCTC No data
Right 921994685 1:221405345-221405367 GGTGAGAATCATTTTACACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921994680 Original CRISPR GAGGATTAAAAAGGAAATAC AGG (reversed) Intergenic
No off target data available for this crispr