ID: 922001876

View in Genome Browser
Species Human (GRCh38)
Location 1:221487088-221487110
Sequence AAAGAGCTGGGGATAGGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922001876_922001883 9 Left 922001876 1:221487088-221487110 CCAGCTCCTATCCCCAGCTCTTT No data
Right 922001883 1:221487120-221487142 CTTTTCATAAGCCTCCTTCTGGG No data
922001876_922001886 24 Left 922001876 1:221487088-221487110 CCAGCTCCTATCCCCAGCTCTTT No data
Right 922001886 1:221487135-221487157 CTTCTGGGCACCAGCTTCTGTGG No data
922001876_922001882 8 Left 922001876 1:221487088-221487110 CCAGCTCCTATCCCCAGCTCTTT No data
Right 922001882 1:221487119-221487141 ACTTTTCATAAGCCTCCTTCTGG No data
922001876_922001887 25 Left 922001876 1:221487088-221487110 CCAGCTCCTATCCCCAGCTCTTT No data
Right 922001887 1:221487136-221487158 TTCTGGGCACCAGCTTCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922001876 Original CRISPR AAAGAGCTGGGGATAGGAGC TGG (reversed) Intergenic
No off target data available for this crispr