ID: 922001877

View in Genome Browser
Species Human (GRCh38)
Location 1:221487094-221487116
Sequence CCAAATAAAGAGCTGGGGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922001877_922001882 2 Left 922001877 1:221487094-221487116 CCTATCCCCAGCTCTTTATTTGG No data
Right 922001882 1:221487119-221487141 ACTTTTCATAAGCCTCCTTCTGG No data
922001877_922001887 19 Left 922001877 1:221487094-221487116 CCTATCCCCAGCTCTTTATTTGG No data
Right 922001887 1:221487136-221487158 TTCTGGGCACCAGCTTCTGTGGG No data
922001877_922001886 18 Left 922001877 1:221487094-221487116 CCTATCCCCAGCTCTTTATTTGG No data
Right 922001886 1:221487135-221487157 CTTCTGGGCACCAGCTTCTGTGG No data
922001877_922001883 3 Left 922001877 1:221487094-221487116 CCTATCCCCAGCTCTTTATTTGG No data
Right 922001883 1:221487120-221487142 CTTTTCATAAGCCTCCTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922001877 Original CRISPR CCAAATAAAGAGCTGGGGAT AGG (reversed) Intergenic
No off target data available for this crispr