ID: 922001879

View in Genome Browser
Species Human (GRCh38)
Location 1:221487099-221487121
Sequence AGTAGCCAAATAAAGAGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922001879_922001887 14 Left 922001879 1:221487099-221487121 CCCCAGCTCTTTATTTGGCTACT No data
Right 922001887 1:221487136-221487158 TTCTGGGCACCAGCTTCTGTGGG No data
922001879_922001882 -3 Left 922001879 1:221487099-221487121 CCCCAGCTCTTTATTTGGCTACT No data
Right 922001882 1:221487119-221487141 ACTTTTCATAAGCCTCCTTCTGG No data
922001879_922001889 26 Left 922001879 1:221487099-221487121 CCCCAGCTCTTTATTTGGCTACT No data
Right 922001889 1:221487148-221487170 GCTTCTGTGGGATGTTCTTTAGG No data
922001879_922001883 -2 Left 922001879 1:221487099-221487121 CCCCAGCTCTTTATTTGGCTACT No data
Right 922001883 1:221487120-221487142 CTTTTCATAAGCCTCCTTCTGGG No data
922001879_922001890 27 Left 922001879 1:221487099-221487121 CCCCAGCTCTTTATTTGGCTACT No data
Right 922001890 1:221487149-221487171 CTTCTGTGGGATGTTCTTTAGGG No data
922001879_922001886 13 Left 922001879 1:221487099-221487121 CCCCAGCTCTTTATTTGGCTACT No data
Right 922001886 1:221487135-221487157 CTTCTGGGCACCAGCTTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922001879 Original CRISPR AGTAGCCAAATAAAGAGCTG GGG (reversed) Intergenic
No off target data available for this crispr