ID: 922001882

View in Genome Browser
Species Human (GRCh38)
Location 1:221487119-221487141
Sequence ACTTTTCATAAGCCTCCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922001881_922001882 -5 Left 922001881 1:221487101-221487123 CCAGCTCTTTATTTGGCTACTTT No data
Right 922001882 1:221487119-221487141 ACTTTTCATAAGCCTCCTTCTGG No data
922001877_922001882 2 Left 922001877 1:221487094-221487116 CCTATCCCCAGCTCTTTATTTGG No data
Right 922001882 1:221487119-221487141 ACTTTTCATAAGCCTCCTTCTGG No data
922001876_922001882 8 Left 922001876 1:221487088-221487110 CCAGCTCCTATCCCCAGCTCTTT No data
Right 922001882 1:221487119-221487141 ACTTTTCATAAGCCTCCTTCTGG No data
922001880_922001882 -4 Left 922001880 1:221487100-221487122 CCCAGCTCTTTATTTGGCTACTT No data
Right 922001882 1:221487119-221487141 ACTTTTCATAAGCCTCCTTCTGG No data
922001870_922001882 29 Left 922001870 1:221487067-221487089 CCTCCTTACTCCCTCTCAGCCCC No data
Right 922001882 1:221487119-221487141 ACTTTTCATAAGCCTCCTTCTGG No data
922001873_922001882 18 Left 922001873 1:221487078-221487100 CCTCTCAGCCCCAGCTCCTATCC No data
Right 922001882 1:221487119-221487141 ACTTTTCATAAGCCTCCTTCTGG No data
922001872_922001882 19 Left 922001872 1:221487077-221487099 CCCTCTCAGCCCCAGCTCCTATC No data
Right 922001882 1:221487119-221487141 ACTTTTCATAAGCCTCCTTCTGG No data
922001875_922001882 9 Left 922001875 1:221487087-221487109 CCCAGCTCCTATCCCCAGCTCTT No data
Right 922001882 1:221487119-221487141 ACTTTTCATAAGCCTCCTTCTGG No data
922001874_922001882 10 Left 922001874 1:221487086-221487108 CCCCAGCTCCTATCCCCAGCTCT No data
Right 922001882 1:221487119-221487141 ACTTTTCATAAGCCTCCTTCTGG No data
922001871_922001882 26 Left 922001871 1:221487070-221487092 CCTTACTCCCTCTCAGCCCCAGC No data
Right 922001882 1:221487119-221487141 ACTTTTCATAAGCCTCCTTCTGG No data
922001879_922001882 -3 Left 922001879 1:221487099-221487121 CCCCAGCTCTTTATTTGGCTACT No data
Right 922001882 1:221487119-221487141 ACTTTTCATAAGCCTCCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922001882 Original CRISPR ACTTTTCATAAGCCTCCTTC TGG Intergenic
No off target data available for this crispr