ID: 922001884

View in Genome Browser
Species Human (GRCh38)
Location 1:221487131-221487153
Sequence AGAAGCTGGTGCCCAGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922001884_922001891 9 Left 922001884 1:221487131-221487153 CCTCCTTCTGGGCACCAGCTTCT No data
Right 922001891 1:221487163-221487185 TCTTTAGGGACCCTCTCAGCTGG No data
922001884_922001889 -6 Left 922001884 1:221487131-221487153 CCTCCTTCTGGGCACCAGCTTCT No data
Right 922001889 1:221487148-221487170 GCTTCTGTGGGATGTTCTTTAGG No data
922001884_922001892 10 Left 922001884 1:221487131-221487153 CCTCCTTCTGGGCACCAGCTTCT No data
Right 922001892 1:221487164-221487186 CTTTAGGGACCCTCTCAGCTGGG No data
922001884_922001893 14 Left 922001884 1:221487131-221487153 CCTCCTTCTGGGCACCAGCTTCT No data
Right 922001893 1:221487168-221487190 AGGGACCCTCTCAGCTGGGCTGG No data
922001884_922001890 -5 Left 922001884 1:221487131-221487153 CCTCCTTCTGGGCACCAGCTTCT No data
Right 922001890 1:221487149-221487171 CTTCTGTGGGATGTTCTTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922001884 Original CRISPR AGAAGCTGGTGCCCAGAAGG AGG (reversed) Intergenic
No off target data available for this crispr