ID: 922001887

View in Genome Browser
Species Human (GRCh38)
Location 1:221487136-221487158
Sequence TTCTGGGCACCAGCTTCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922001879_922001887 14 Left 922001879 1:221487099-221487121 CCCCAGCTCTTTATTTGGCTACT No data
Right 922001887 1:221487136-221487158 TTCTGGGCACCAGCTTCTGTGGG No data
922001875_922001887 26 Left 922001875 1:221487087-221487109 CCCAGCTCCTATCCCCAGCTCTT No data
Right 922001887 1:221487136-221487158 TTCTGGGCACCAGCTTCTGTGGG No data
922001877_922001887 19 Left 922001877 1:221487094-221487116 CCTATCCCCAGCTCTTTATTTGG No data
Right 922001887 1:221487136-221487158 TTCTGGGCACCAGCTTCTGTGGG No data
922001874_922001887 27 Left 922001874 1:221487086-221487108 CCCCAGCTCCTATCCCCAGCTCT No data
Right 922001887 1:221487136-221487158 TTCTGGGCACCAGCTTCTGTGGG No data
922001880_922001887 13 Left 922001880 1:221487100-221487122 CCCAGCTCTTTATTTGGCTACTT No data
Right 922001887 1:221487136-221487158 TTCTGGGCACCAGCTTCTGTGGG No data
922001881_922001887 12 Left 922001881 1:221487101-221487123 CCAGCTCTTTATTTGGCTACTTT No data
Right 922001887 1:221487136-221487158 TTCTGGGCACCAGCTTCTGTGGG No data
922001876_922001887 25 Left 922001876 1:221487088-221487110 CCAGCTCCTATCCCCAGCTCTTT No data
Right 922001887 1:221487136-221487158 TTCTGGGCACCAGCTTCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922001887 Original CRISPR TTCTGGGCACCAGCTTCTGT GGG Intergenic
No off target data available for this crispr