ID: 922001889

View in Genome Browser
Species Human (GRCh38)
Location 1:221487148-221487170
Sequence GCTTCTGTGGGATGTTCTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922001881_922001889 24 Left 922001881 1:221487101-221487123 CCAGCTCTTTATTTGGCTACTTT No data
Right 922001889 1:221487148-221487170 GCTTCTGTGGGATGTTCTTTAGG No data
922001885_922001889 -9 Left 922001885 1:221487134-221487156 CCTTCTGGGCACCAGCTTCTGTG No data
Right 922001889 1:221487148-221487170 GCTTCTGTGGGATGTTCTTTAGG No data
922001884_922001889 -6 Left 922001884 1:221487131-221487153 CCTCCTTCTGGGCACCAGCTTCT No data
Right 922001889 1:221487148-221487170 GCTTCTGTGGGATGTTCTTTAGG No data
922001880_922001889 25 Left 922001880 1:221487100-221487122 CCCAGCTCTTTATTTGGCTACTT No data
Right 922001889 1:221487148-221487170 GCTTCTGTGGGATGTTCTTTAGG No data
922001879_922001889 26 Left 922001879 1:221487099-221487121 CCCCAGCTCTTTATTTGGCTACT No data
Right 922001889 1:221487148-221487170 GCTTCTGTGGGATGTTCTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922001889 Original CRISPR GCTTCTGTGGGATGTTCTTT AGG Intergenic
No off target data available for this crispr