ID: 922001890

View in Genome Browser
Species Human (GRCh38)
Location 1:221487149-221487171
Sequence CTTCTGTGGGATGTTCTTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922001884_922001890 -5 Left 922001884 1:221487131-221487153 CCTCCTTCTGGGCACCAGCTTCT No data
Right 922001890 1:221487149-221487171 CTTCTGTGGGATGTTCTTTAGGG No data
922001885_922001890 -8 Left 922001885 1:221487134-221487156 CCTTCTGGGCACCAGCTTCTGTG No data
Right 922001890 1:221487149-221487171 CTTCTGTGGGATGTTCTTTAGGG No data
922001879_922001890 27 Left 922001879 1:221487099-221487121 CCCCAGCTCTTTATTTGGCTACT No data
Right 922001890 1:221487149-221487171 CTTCTGTGGGATGTTCTTTAGGG No data
922001880_922001890 26 Left 922001880 1:221487100-221487122 CCCAGCTCTTTATTTGGCTACTT No data
Right 922001890 1:221487149-221487171 CTTCTGTGGGATGTTCTTTAGGG No data
922001881_922001890 25 Left 922001881 1:221487101-221487123 CCAGCTCTTTATTTGGCTACTTT No data
Right 922001890 1:221487149-221487171 CTTCTGTGGGATGTTCTTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922001890 Original CRISPR CTTCTGTGGGATGTTCTTTA GGG Intergenic
No off target data available for this crispr