ID: 922005710

View in Genome Browser
Species Human (GRCh38)
Location 1:221528685-221528707
Sequence TTAGCTACACAGATCAACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922005707_922005710 -1 Left 922005707 1:221528663-221528685 CCCTCACATACGCCGTATTTTAT No data
Right 922005710 1:221528685-221528707 TTAGCTACACAGATCAACCCTGG No data
922005708_922005710 -2 Left 922005708 1:221528664-221528686 CCTCACATACGCCGTATTTTATT No data
Right 922005710 1:221528685-221528707 TTAGCTACACAGATCAACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922005710 Original CRISPR TTAGCTACACAGATCAACCC TGG Intergenic
No off target data available for this crispr