ID: 922006611

View in Genome Browser
Species Human (GRCh38)
Location 1:221537274-221537296
Sequence CTAAGTGGGAGTTGGTCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922006604_922006611 -8 Left 922006604 1:221537259-221537281 CCCAGAGCCCAAAAGCTAAGTGG No data
Right 922006611 1:221537274-221537296 CTAAGTGGGAGTTGGTCAGATGG No data
922006602_922006611 19 Left 922006602 1:221537232-221537254 CCAATCTTGAGTATGGAGAACAG No data
Right 922006611 1:221537274-221537296 CTAAGTGGGAGTTGGTCAGATGG No data
922006606_922006611 -9 Left 922006606 1:221537260-221537282 CCAGAGCCCAAAAGCTAAGTGGG No data
Right 922006611 1:221537274-221537296 CTAAGTGGGAGTTGGTCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922006611 Original CRISPR CTAAGTGGGAGTTGGTCAGA TGG Intergenic
No off target data available for this crispr