ID: 922007051

View in Genome Browser
Species Human (GRCh38)
Location 1:221541762-221541784
Sequence CTTTGCTAGCAGGAGTGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922007046_922007051 25 Left 922007046 1:221541714-221541736 CCTGTCAGTGGAAGTGTGTGTCT No data
Right 922007051 1:221541762-221541784 CTTTGCTAGCAGGAGTGTGAGGG No data
922007048_922007051 -3 Left 922007048 1:221541742-221541764 CCTTGTGCACTTACACACGGCTT No data
Right 922007051 1:221541762-221541784 CTTTGCTAGCAGGAGTGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922007051 Original CRISPR CTTTGCTAGCAGGAGTGTGA GGG Intergenic
No off target data available for this crispr