ID: 922008453

View in Genome Browser
Species Human (GRCh38)
Location 1:221556054-221556076
Sequence GTTTTAAGGCACCCTGAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922008453_922008459 17 Left 922008453 1:221556054-221556076 CCAGACTCAGGGTGCCTTAAAAC No data
Right 922008459 1:221556094-221556116 TGTTTGAGCTTTGAGGGGGTTGG No data
922008453_922008456 11 Left 922008453 1:221556054-221556076 CCAGACTCAGGGTGCCTTAAAAC No data
Right 922008456 1:221556088-221556110 CAACTGTGTTTGAGCTTTGAGGG No data
922008453_922008458 13 Left 922008453 1:221556054-221556076 CCAGACTCAGGGTGCCTTAAAAC No data
Right 922008458 1:221556090-221556112 ACTGTGTTTGAGCTTTGAGGGGG No data
922008453_922008460 18 Left 922008453 1:221556054-221556076 CCAGACTCAGGGTGCCTTAAAAC No data
Right 922008460 1:221556095-221556117 GTTTGAGCTTTGAGGGGGTTGGG No data
922008453_922008461 19 Left 922008453 1:221556054-221556076 CCAGACTCAGGGTGCCTTAAAAC No data
Right 922008461 1:221556096-221556118 TTTGAGCTTTGAGGGGGTTGGGG No data
922008453_922008455 10 Left 922008453 1:221556054-221556076 CCAGACTCAGGGTGCCTTAAAAC No data
Right 922008455 1:221556087-221556109 TCAACTGTGTTTGAGCTTTGAGG No data
922008453_922008457 12 Left 922008453 1:221556054-221556076 CCAGACTCAGGGTGCCTTAAAAC No data
Right 922008457 1:221556089-221556111 AACTGTGTTTGAGCTTTGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922008453 Original CRISPR GTTTTAAGGCACCCTGAGTC TGG (reversed) Intergenic
No off target data available for this crispr