ID: 922008460

View in Genome Browser
Species Human (GRCh38)
Location 1:221556095-221556117
Sequence GTTTGAGCTTTGAGGGGGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922008453_922008460 18 Left 922008453 1:221556054-221556076 CCAGACTCAGGGTGCCTTAAAAC No data
Right 922008460 1:221556095-221556117 GTTTGAGCTTTGAGGGGGTTGGG No data
922008454_922008460 4 Left 922008454 1:221556068-221556090 CCTTAAAACACAAAGTGCTTCAA No data
Right 922008460 1:221556095-221556117 GTTTGAGCTTTGAGGGGGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922008460 Original CRISPR GTTTGAGCTTTGAGGGGGTT GGG Intergenic
No off target data available for this crispr