ID: 922016034

View in Genome Browser
Species Human (GRCh38)
Location 1:221648193-221648215
Sequence CACCAAATGGTTGTTCCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922016034_922016038 -8 Left 922016034 1:221648193-221648215 CCAGTGGGAACAACCATTTGGTG No data
Right 922016038 1:221648208-221648230 ATTTGGTGATTTAAGCAGGTGGG No data
922016034_922016043 13 Left 922016034 1:221648193-221648215 CCAGTGGGAACAACCATTTGGTG No data
Right 922016043 1:221648229-221648251 GGTGTTGGGACACATGGGAGTGG No data
922016034_922016037 -9 Left 922016034 1:221648193-221648215 CCAGTGGGAACAACCATTTGGTG No data
Right 922016037 1:221648207-221648229 CATTTGGTGATTTAAGCAGGTGG No data
922016034_922016042 8 Left 922016034 1:221648193-221648215 CCAGTGGGAACAACCATTTGGTG No data
Right 922016042 1:221648224-221648246 AGGTGGGTGTTGGGACACATGGG No data
922016034_922016040 -1 Left 922016034 1:221648193-221648215 CCAGTGGGAACAACCATTTGGTG No data
Right 922016040 1:221648215-221648237 GATTTAAGCAGGTGGGTGTTGGG No data
922016034_922016041 7 Left 922016034 1:221648193-221648215 CCAGTGGGAACAACCATTTGGTG No data
Right 922016041 1:221648223-221648245 CAGGTGGGTGTTGGGACACATGG No data
922016034_922016039 -2 Left 922016034 1:221648193-221648215 CCAGTGGGAACAACCATTTGGTG No data
Right 922016039 1:221648214-221648236 TGATTTAAGCAGGTGGGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922016034 Original CRISPR CACCAAATGGTTGTTCCCAC TGG (reversed) Intergenic
No off target data available for this crispr