ID: 922016037

View in Genome Browser
Species Human (GRCh38)
Location 1:221648207-221648229
Sequence CATTTGGTGATTTAAGCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922016032_922016037 -5 Left 922016032 1:221648189-221648211 CCATCCAGTGGGAACAACCATTT No data
Right 922016037 1:221648207-221648229 CATTTGGTGATTTAAGCAGGTGG No data
922016027_922016037 25 Left 922016027 1:221648159-221648181 CCCTGGTGGGTGAGAAGGGGTAG No data
Right 922016037 1:221648207-221648229 CATTTGGTGATTTAAGCAGGTGG No data
922016034_922016037 -9 Left 922016034 1:221648193-221648215 CCAGTGGGAACAACCATTTGGTG No data
Right 922016037 1:221648207-221648229 CATTTGGTGATTTAAGCAGGTGG No data
922016028_922016037 24 Left 922016028 1:221648160-221648182 CCTGGTGGGTGAGAAGGGGTAGC No data
Right 922016037 1:221648207-221648229 CATTTGGTGATTTAAGCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922016037 Original CRISPR CATTTGGTGATTTAAGCAGG TGG Intergenic
No off target data available for this crispr