ID: 922016038

View in Genome Browser
Species Human (GRCh38)
Location 1:221648208-221648230
Sequence ATTTGGTGATTTAAGCAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922016027_922016038 26 Left 922016027 1:221648159-221648181 CCCTGGTGGGTGAGAAGGGGTAG No data
Right 922016038 1:221648208-221648230 ATTTGGTGATTTAAGCAGGTGGG No data
922016032_922016038 -4 Left 922016032 1:221648189-221648211 CCATCCAGTGGGAACAACCATTT No data
Right 922016038 1:221648208-221648230 ATTTGGTGATTTAAGCAGGTGGG No data
922016034_922016038 -8 Left 922016034 1:221648193-221648215 CCAGTGGGAACAACCATTTGGTG No data
Right 922016038 1:221648208-221648230 ATTTGGTGATTTAAGCAGGTGGG No data
922016028_922016038 25 Left 922016028 1:221648160-221648182 CCTGGTGGGTGAGAAGGGGTAGC No data
Right 922016038 1:221648208-221648230 ATTTGGTGATTTAAGCAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922016038 Original CRISPR ATTTGGTGATTTAAGCAGGT GGG Intergenic
No off target data available for this crispr