ID: 922016040

View in Genome Browser
Species Human (GRCh38)
Location 1:221648215-221648237
Sequence GATTTAAGCAGGTGGGTGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922016034_922016040 -1 Left 922016034 1:221648193-221648215 CCAGTGGGAACAACCATTTGGTG No data
Right 922016040 1:221648215-221648237 GATTTAAGCAGGTGGGTGTTGGG No data
922016032_922016040 3 Left 922016032 1:221648189-221648211 CCATCCAGTGGGAACAACCATTT No data
Right 922016040 1:221648215-221648237 GATTTAAGCAGGTGGGTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922016040 Original CRISPR GATTTAAGCAGGTGGGTGTT GGG Intergenic
No off target data available for this crispr