ID: 922016041

View in Genome Browser
Species Human (GRCh38)
Location 1:221648223-221648245
Sequence CAGGTGGGTGTTGGGACACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922016034_922016041 7 Left 922016034 1:221648193-221648215 CCAGTGGGAACAACCATTTGGTG No data
Right 922016041 1:221648223-221648245 CAGGTGGGTGTTGGGACACATGG No data
922016032_922016041 11 Left 922016032 1:221648189-221648211 CCATCCAGTGGGAACAACCATTT No data
Right 922016041 1:221648223-221648245 CAGGTGGGTGTTGGGACACATGG No data
922016036_922016041 -6 Left 922016036 1:221648206-221648228 CCATTTGGTGATTTAAGCAGGTG No data
Right 922016041 1:221648223-221648245 CAGGTGGGTGTTGGGACACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922016041 Original CRISPR CAGGTGGGTGTTGGGACACA TGG Intergenic
No off target data available for this crispr