ID: 922018960

View in Genome Browser
Species Human (GRCh38)
Location 1:221684546-221684568
Sequence GAAATCAGTACTTCCAGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922018956_922018960 -8 Left 922018956 1:221684531-221684553 CCCATCCAATATAATGAAATCAG No data
Right 922018960 1:221684546-221684568 GAAATCAGTACTTCCAGAGGTGG No data
922018957_922018960 -9 Left 922018957 1:221684532-221684554 CCATCCAATATAATGAAATCAGT No data
Right 922018960 1:221684546-221684568 GAAATCAGTACTTCCAGAGGTGG No data
922018955_922018960 -7 Left 922018955 1:221684530-221684552 CCCCATCCAATATAATGAAATCA No data
Right 922018960 1:221684546-221684568 GAAATCAGTACTTCCAGAGGTGG No data
922018949_922018960 25 Left 922018949 1:221684498-221684520 CCTACAGACCCTTCTACATGCAC No data
Right 922018960 1:221684546-221684568 GAAATCAGTACTTCCAGAGGTGG No data
922018953_922018960 16 Left 922018953 1:221684507-221684529 CCTTCTACATGCACGGTATTGGG No data
Right 922018960 1:221684546-221684568 GAAATCAGTACTTCCAGAGGTGG No data
922018951_922018960 17 Left 922018951 1:221684506-221684528 CCCTTCTACATGCACGGTATTGG No data
Right 922018960 1:221684546-221684568 GAAATCAGTACTTCCAGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922018960 Original CRISPR GAAATCAGTACTTCCAGAGG TGG Intergenic