ID: 922023165

View in Genome Browser
Species Human (GRCh38)
Location 1:221724721-221724743
Sequence GTGTGTGCATGCACATGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 469
Summary {0: 1, 1: 0, 2: 12, 3: 60, 4: 396}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922023161_922023165 24 Left 922023161 1:221724674-221724696 CCATTCTACAAATGTTAACTAAA 0: 1
1: 0
2: 3
3: 53
4: 521
Right 922023165 1:221724721-221724743 GTGTGTGCATGCACATGGAGGGG 0: 1
1: 0
2: 12
3: 60
4: 396
922023160_922023165 25 Left 922023160 1:221724673-221724695 CCCATTCTACAAATGTTAACTAA 0: 1
1: 0
2: 1
3: 30
4: 371
Right 922023165 1:221724721-221724743 GTGTGTGCATGCACATGGAGGGG 0: 1
1: 0
2: 12
3: 60
4: 396

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922023165 Original CRISPR GTGTGTGCATGCACATGGAG GGG Intronic
900122093 1:1053017-1053039 GTATGTGTGTGAACATGGAGGGG + Intronic
900229059 1:1547073-1547095 TTGTGTGCAGCCACATGCAGAGG + Intronic
900426868 1:2584923-2584945 GTGTGTGTTTGCATATGTAGGGG - Intergenic
900646414 1:3710761-3710783 GTGTGTGCATGCATGTGGGAGGG - Intronic
901404841 1:9039031-9039053 GAGTGTGCGTGCACATGGGTGGG - Intronic
901560202 1:10064066-10064088 GAGTGTGTATGGACATGGTGAGG - Intronic
901633602 1:10659525-10659547 GTGTGTGGAAGCGCATGGATGGG + Intronic
902391918 1:16111903-16111925 GTGTGTGTGTGCACGTGGTGGGG - Intergenic
902954378 1:19915019-19915041 GTGTGTGCATGCATAGAGACGGG - Intergenic
903343717 1:22671236-22671258 GTGAGTGCCTGCTCCTGGAGAGG - Intergenic
903655842 1:24948359-24948381 GTGTTCACATGCACATGGTGGGG + Intronic
904357306 1:29948692-29948714 GTGTGTGTGTGCACAGGCAGAGG - Intergenic
905426362 1:37888198-37888220 CTGTGTGCTTGAAGATGGAGAGG + Intronic
905435804 1:37954400-37954422 GAGTGTGCATGCACAAGGCAGGG + Intergenic
905506954 1:38487498-38487520 GTGTGTGTTTGTACTTGGAGAGG - Intergenic
908173622 1:61532190-61532212 GTGTGTGCATATAGATGAAGAGG + Intergenic
909301410 1:74017489-74017511 GTGTGTGCATGCCCTTTGATGGG - Intergenic
911717867 1:101155514-101155536 GTGGGTGCTTGCACATGGCGGGG + Intergenic
912199380 1:107439302-107439324 GTGTGAGCATGCACATGTGTTGG + Intronic
912750861 1:112286224-112286246 GTGTTTGCATGCACGTGGAGTGG + Intergenic
912881895 1:113423924-113423946 GGGTGTGCAAGCACTTGGGGTGG - Intronic
913111231 1:115658932-115658954 GTGTGTGTGTGTACATGGGGAGG - Intronic
915549912 1:156625778-156625800 GTGTGTGCACGCTCATGTCGGGG + Intergenic
915939060 1:160106894-160106916 GTGTGTGCCTGTACGTGGACGGG - Intergenic
915939925 1:160112552-160112574 ATGTGTGTGTGCACAGGGAGGGG - Intergenic
916966197 1:169945170-169945192 GGGTGTGCCTGCACTTGGGGCGG - Intronic
917389220 1:174515374-174515396 GTGTGTGCATGCACAAACACAGG - Intronic
918047044 1:180947919-180947941 GTGTGTGCACTCACATCGACAGG - Exonic
919399353 1:197091240-197091262 GTGTGTGCACACACATGCACAGG + Intronic
920297705 1:204969152-204969174 GTGTGTGCATGCCCGTGCATGGG + Intronic
920458218 1:206116925-206116947 GGGTGTGGATGCAAGTGGAGAGG + Exonic
920853692 1:209646701-209646723 GTGGCTGCATCCACATGCAGAGG - Intronic
921055915 1:211542369-211542391 GTGTGTGTGTGCACGTGGGGTGG - Intergenic
921874703 1:220181393-220181415 GTGTATGCATGCATGTGTAGGGG + Intronic
921939264 1:220823271-220823293 GTGTGTGCATGCATGTGTGGGGG + Intergenic
921960524 1:221029062-221029084 GTGTGTGCATGTACATGTTCGGG - Intergenic
922023165 1:221724721-221724743 GTGTGTGCATGCACATGGAGGGG + Intronic
922746384 1:228046556-228046578 GTGTGTGCATGTGCATGGGGTGG + Intronic
922755865 1:228096687-228096709 GTGTGGGCAGGCACAGTGAGTGG + Intronic
922893733 1:229083308-229083330 GTGTGTGCATGGAGAAAGAGAGG - Intergenic
922962061 1:229656015-229656037 GTGTGTGCACTCACATGGCCAGG - Intronic
922996981 1:229971955-229971977 CTGTGTGTATGTACATGGTGGGG - Intergenic
923047886 1:230368805-230368827 GAGTGAGCATGCACATGCAGAGG + Intronic
1063130483 10:3173139-3173161 GCGTGTGTATGCAGATGAAGTGG + Intergenic
1063155501 10:3375674-3375696 GTGTGTGGATGCCCAGGCAGGGG - Intergenic
1063382103 10:5591895-5591917 GTGTGCGCGTGCACGTGCAGAGG - Intergenic
1064300151 10:14116143-14116165 TTCTGTGCATGCAAATGGAAGGG + Intronic
1064710901 10:18123419-18123441 GTGGGTTAATGCAAATGGAGGGG - Intergenic
1067473895 10:46554003-46554025 GTGAGTACATGCACAGGAAGGGG - Intronic
1067552671 10:47246452-47246474 GTGTGTGCATGTGCATGGAGAGG - Intergenic
1069851596 10:71408961-71408983 GTGTGTGCATGTGCATGCATTGG + Intronic
1069992103 10:72322325-72322347 CTGTGTGCGTGCACAGGGAGGGG + Intergenic
1070724222 10:78777465-78777487 GGGTGCCCAGGCACATGGAGGGG + Intergenic
1071953600 10:90732813-90732835 GTGTGTGCATGCACATGTATAGG + Intergenic
1072205199 10:93197539-93197561 GTGTTTGCATGCATTTTGAGGGG + Intergenic
1073037294 10:100572960-100572982 GTGTGTGCACACGCATGGGGGGG + Intergenic
1073117465 10:101099658-101099680 GTGTGTGCATGTGCATGGCAGGG - Intronic
1073448024 10:103592592-103592614 GCGTGTGCGTGCACATGTGGGGG + Intergenic
1073574273 10:104608667-104608689 ATGTGTCCTTGCACATGGAGTGG - Intergenic
1074134898 10:110617844-110617866 GTGTGTACATGCTCATGTACTGG + Intergenic
1074630610 10:115250989-115251011 TAGTTTGCATTCACATGGAGGGG - Intronic
1075341381 10:121649146-121649168 GTGTGTGCCTGCACATCAACTGG + Intergenic
1075406946 10:122201364-122201386 GTGGCTGCATTCACATGGGGAGG + Intronic
1075783072 10:125029652-125029674 GGGTGTGCATGCACCATGAGTGG - Intronic
1076496647 10:130901746-130901768 GTGTGTGGCTGCAGATGAAGTGG + Intergenic
1076866014 10:133166733-133166755 GTTTGTGCATGTGCATGGGGGGG + Intronic
1077383177 11:2256995-2257017 GTGTGTGCATGCATATGTGCAGG + Intergenic
1077731190 11:4731706-4731728 ATGTGTGCATGCACATGTGTGGG + Intronic
1078364026 11:10692180-10692202 GTGTGTGCATGCATATTTGGTGG - Intronic
1080999416 11:37650038-37650060 GTGTGTGTATGCATGTGTAGGGG - Intergenic
1081048781 11:38311363-38311385 GTGTTTGCATGTGCATGGATGGG + Intergenic
1081194523 11:40145074-40145096 GTGTATGCATGCCCATGGAATGG - Intronic
1082281571 11:50276339-50276361 GTGTGTGCATGTAAATGCTGGGG + Intergenic
1083104128 11:60341572-60341594 GTGTGTGCATGAGCAAGGTGAGG - Intronic
1083548187 11:63564485-63564507 GTGTGGGGATGCAGATGGACTGG + Intergenic
1084033196 11:66492963-66492985 GTGTGTGTGTGGACAGGGAGGGG - Intronic
1084219394 11:67667983-67668005 GTGTGTGTCTGCGCAAGGAGGGG - Intronic
1084313277 11:68329001-68329023 GTGTGTGCATGCACACGTGTGGG - Intronic
1084592698 11:70099695-70099717 GTCTGTGCTTGCACAGGCAGGGG + Intronic
1084692155 11:70733827-70733849 GTCTGTGCAGGCACAGGGAACGG + Intronic
1084699723 11:70778583-70778605 AGGTGTGCATGCACAAGGAAAGG + Intronic
1084754039 11:71223283-71223305 GGGTGTGCATTCTCATGGGGTGG + Intronic
1085042999 11:73337895-73337917 GTGCGTGTATGCACCTGGGGTGG - Intronic
1085761026 11:79241726-79241748 GTGTGTGCATGTGTATGGTGGGG + Intronic
1085859432 11:80214679-80214701 GTGTGTACTAGCACCTGGAGTGG - Intergenic
1086539116 11:87886329-87886351 GTGTGTGCATGCACATGTGCAGG + Intergenic
1087072355 11:94093674-94093696 ATGTGTGCATGCACATGCTTGGG - Intronic
1088566384 11:111177253-111177275 GTGTGTGCATGCACACACAAGGG + Intergenic
1088937841 11:114421521-114421543 GTGTGTGCATGGAGGTAGAGGGG + Intronic
1089287789 11:117418841-117418863 ATGAGTGTATGCACATGCAGGGG + Intergenic
1089623782 11:119738359-119738381 GTGTGTGCATTCACATGCATAGG - Intergenic
1090344605 11:126059518-126059540 GTGTGTGTGTGCAGAGGGAGTGG - Intronic
1090650729 11:128803668-128803690 TTGTGTGCATGGCCAGGGAGTGG - Intronic
1090882120 11:130842821-130842843 GTGTGTGCATAAACAGAGAGTGG + Intergenic
1090996130 11:131867323-131867345 CTGTGTGCGTGCGGATGGAGAGG + Intronic
1093101681 12:15036566-15036588 GTGTGTGTTTGCACATGTGGAGG - Intergenic
1093879769 12:24390611-24390633 GTGTATACATGGACATAGAGAGG - Intergenic
1099603975 12:84778236-84778258 GTCTGTGCATGTAGATGGATTGG - Intergenic
1100580844 12:95939173-95939195 GGGAGTGTAAGCACATGGAGAGG + Intronic
1100813270 12:98361471-98361493 GTGTGTTCATGCATGTGGTGGGG + Intergenic
1101921302 12:108935359-108935381 ATGTGTGCAAGCAAATGTAGTGG + Intronic
1102484601 12:113247293-113247315 GGGTGTGAGTGCAGATGGAGTGG - Intronic
1102533044 12:113560950-113560972 GTGCGTGCATGCATGTAGAGTGG - Intergenic
1102556422 12:113729687-113729709 GAGGCTGCAGGCACATGGAGGGG - Intergenic
1102666743 12:114580837-114580859 GTCTGTACTTGCACATGGGGGGG - Intergenic
1104775126 12:131386264-131386286 GAGTGTGCATGGAGAGGGAGGGG + Intergenic
1104894716 12:132158536-132158558 GTGTGTGTGTGCGCATGTAGTGG - Intergenic
1105323263 13:19347223-19347245 GTGTGTGCGCGCACTTGGTGGGG - Intergenic
1105969910 13:25419083-25419105 GTGTGTGCACGCACGTGTTGAGG + Intronic
1106113341 13:26795986-26796008 GTGTGTGTGTGCAGGTGGAGAGG + Intergenic
1106213755 13:27675465-27675487 GTGTGTGCATTCACATGTGTGGG + Intergenic
1106594862 13:31127353-31127375 GTGTGTGCATGCATATGCATGGG + Intergenic
1107045047 13:35984882-35984904 GTGTGTGCATGCGCACGCTGGGG - Intronic
1107228991 13:38086059-38086081 GTGTGTGTGTGCACCTGGGGAGG + Intergenic
1107286015 13:38793145-38793167 CTGTGTGCCTGCACATGGCTAGG + Intronic
1107299071 13:38946655-38946677 GTGTGTCCATGCATGTGGAAGGG - Intergenic
1107699891 13:43036822-43036844 GGGTGTGCATGCACTAAGAGCGG - Intronic
1107934436 13:45333426-45333448 GTGTGTGCACACAGGTGGAGTGG - Intergenic
1108146323 13:47480967-47480989 GTGTGTGCATGCACAAAGTTTGG - Intergenic
1108146698 13:47484691-47484713 GTGTGTGCATGCGCATGTGCAGG - Intergenic
1108600090 13:51985171-51985193 GTGTGTGTTTGCACATGAGGTGG - Intronic
1109133005 13:58611688-58611710 CTGTCTGCATGCACCCGGAGAGG + Intergenic
1109253363 13:60048057-60048079 GTGAATGCCTGCACATGCAGTGG + Intronic
1109916403 13:68991063-68991085 ATGTGAGCATGCACATGTAACGG + Intergenic
1111186858 13:84748800-84748822 GTGTGTGCATCAATATGGAGAGG - Intergenic
1112500249 13:99937565-99937587 GTTTGTGCAGATACATGGAGTGG - Intergenic
1117002205 14:51382238-51382260 GTGTGTGTGTGTACATGGAGGGG + Intergenic
1118655130 14:67939215-67939237 GTATGTGTTTCCACATGGAGGGG - Intronic
1119350042 14:73956947-73956969 GTGTGTGCATGTACATGCATAGG + Intronic
1119778698 14:77264264-77264286 GTGTGTGCATGGGCATGCACTGG - Intergenic
1119988303 14:79165698-79165720 GTGTGTGCATGGACAGGGAGGGG + Intronic
1120811719 14:88810602-88810624 GTGTGTGTGTGCATATGGAAGGG - Intergenic
1121632788 14:95433144-95433166 GTGTGTGAATGCACAGGGCAGGG + Intronic
1122043614 14:99007926-99007948 GTGTGTGCACGCACATGCAATGG - Intergenic
1122259285 14:100503071-100503093 GTGTGTGCATGCGCATTCAGAGG + Intronic
1122298961 14:100721175-100721197 GTGTATGCATGCACATGAGATGG - Intergenic
1122356810 14:101127600-101127622 GTGTGTGCATGCACAGAAAACGG - Intergenic
1123428537 15:20193700-20193722 GTGTGTGCGCGCACATAGCGGGG + Intergenic
1123827615 15:24099411-24099433 GGGTCTGCATGCACAAGGGGAGG + Intergenic
1123842073 15:24258793-24258815 GGGTCTGCATGCACAAGGGGAGG + Intergenic
1123857091 15:24424870-24424892 GGGTCTGCATGCACAAGGGGAGG + Intergenic
1123861724 15:24475398-24475420 GGGTCTGCATGCACAAGGGGAGG + Intergenic
1123945727 15:25237950-25237972 CTGTTTGCATGCAAAGGGAGGGG + Intergenic
1124635103 15:31360252-31360274 GTGTGGGCACGGACATGCAGCGG + Intronic
1124686397 15:31786483-31786505 GTGTGTGCCTGGACAGGGTGTGG + Intronic
1125733820 15:41909850-41909872 ATGTAGGCATGCACCTGGAGGGG + Exonic
1127924863 15:63529625-63529647 ATGTGTTCATGCACCTTGAGTGG + Intronic
1128374831 15:67066967-67066989 GTGCGTGCATGCTCAGGGGGCGG - Intronic
1129228915 15:74185611-74185633 TTGTGTGCATGGCCAGGGAGAGG - Intronic
1130043745 15:80428212-80428234 GTCTGTGCATCGACATGGTGAGG - Intronic
1130051877 15:80490589-80490611 GGGTCTGCATCCACATGGAGGGG - Intronic
1130550399 15:84886869-84886891 GTGTGTGCACGCACATGCACGGG + Intronic
1130739906 15:86587988-86588010 ATGTATGCATGTACATGGAAAGG + Intronic
1130931237 15:88429553-88429575 GTGTGCGCATGCACATACATAGG - Intergenic
1131438350 15:92440416-92440438 GTGTGTGACTGCACGTGGACAGG + Intronic
1132124657 15:99212286-99212308 GTGTGTGCATGCATGTGCAATGG + Intronic
1132318633 15:100909038-100909060 GGGTTTGCACGCGCATGGAGGGG - Intronic
1132548307 16:543732-543754 GCCTGTGCATGCACGTGGTGGGG - Intronic
1132984492 16:2757364-2757386 GTGTGCGCATGGAGAGGGAGGGG + Intronic
1133496789 16:6326030-6326052 GTGTGTACATGCATATGCATTGG + Intronic
1133688419 16:8189293-8189315 ATGTGAGCAAGCTCATGGAGGGG - Intergenic
1134373060 16:13643726-13643748 GTGTGTGCATGCCTGTGGGGAGG + Intergenic
1135142248 16:19931826-19931848 GTGTGCGCATGCATGTGGGGAGG + Intergenic
1135830028 16:25764871-25764893 GTGTGTGCATGAACTTGCTGTGG + Intronic
1136623123 16:31443099-31443121 GTGTGTGCATGCGCATGGCGCGG - Intronic
1137484944 16:48882900-48882922 GTGTGAGCCTGAACATGCAGGGG - Intergenic
1137561069 16:49502755-49502777 GTGTGTGCATGCATATAGAGTGG - Intronic
1137641712 16:50037479-50037501 GTCTTTGCATGCACTTGGAGGGG + Intergenic
1137767066 16:50985852-50985874 GTGTGTGCATGTACACAGAGGGG + Intergenic
1138431808 16:56973564-56973586 GTGTGTGCACACGCATGGGGAGG + Intronic
1138576809 16:57912898-57912920 GTGCATGCATGCACATGCAGGGG + Intronic
1139295346 16:65895649-65895671 GGGTTAGCATGCACATGGACAGG - Intergenic
1139641781 16:68296847-68296869 ATGTGTGCATGCGCATGCAGAGG + Intronic
1140110759 16:72002635-72002657 GTGTGTGTGTGTACATGTAGGGG + Intergenic
1141296519 16:82774814-82774836 GTGTGTTCCTGCACCTGGTGGGG + Intronic
1141304749 16:82851695-82851717 GTGTGTGCATGCACATGTCCTGG + Intronic
1141416807 16:83881829-83881851 GTGTGTGCATTTACAGGGAAGGG - Intergenic
1143330127 17:6128334-6128356 GTGTGTTCATGAAAATAGAGGGG + Intergenic
1143963556 17:10739545-10739567 GTGTGTGTGTGCACGTGAAGTGG - Intergenic
1144801159 17:17928576-17928598 GTGTGTGCATGCTCACGCGGGGG - Intronic
1144815363 17:18030596-18030618 ATGTGTGCATGGACAGGGAAGGG + Intronic
1145281196 17:21468255-21468277 GTGGGTGCATGCAGAGGGCGGGG - Intergenic
1145977978 17:28995332-28995354 GTGTGTGCATGTATGTGGGGGGG + Intronic
1148578469 17:48727432-48727454 GTGTGTGTATGCGCATGTATTGG - Intronic
1149287819 17:55185453-55185475 GTGTGTGTGTGCACATAGAGAGG + Intergenic
1151379061 17:73712279-73712301 GTGTGTGCGTGCACATGTGGGGG + Intergenic
1151713126 17:75817970-75817992 GTGTGTGCATGCATGTGAAGAGG + Intronic
1151914579 17:77108090-77108112 GTGTGTGCGTGCGCATGGTATGG - Intronic
1152788975 17:82268031-82268053 CTGTGTGCTTGCACAGCGAGAGG - Intronic
1152850403 17:82630474-82630496 GTGTGTGTATGCAGATGATGTGG - Intronic
1154183647 18:12160294-12160316 GTGTGTGCATGTACATGTGTAGG + Intergenic
1155386401 18:25282538-25282560 GTGTGAGCTTGCACATGGAGGGG + Intronic
1155408462 18:25515498-25515520 GTGGGTGTATTGACATGGAGGGG - Intergenic
1156188582 18:34691789-34691811 ATGAGTGCATGCAGATGAAGGGG - Intronic
1156464362 18:37339382-37339404 GTGGGTCCATGCAGATGGATAGG + Intronic
1157409283 18:47450114-47450136 ATGTGTGCATTCACATAAAGGGG - Intergenic
1158017149 18:52797677-52797699 GTGTGTGCAGGCACCAGCAGTGG + Intronic
1159274002 18:66192157-66192179 ATGTGTGCATGCGTGTGGAGAGG - Intergenic
1159985426 18:74835656-74835678 GTGTGTGTGTGTAAATGGAGAGG + Intronic
1160518063 18:79489263-79489285 GACTGTGCGTGGACATGGAGGGG + Intronic
1161316112 19:3618406-3618428 GTGTGTGCAACCACACGGAGGGG + Intronic
1161346551 19:3771303-3771325 GTGTGTGCAAAGACATGGAGGGG - Intronic
1161725843 19:5928190-5928212 GGGAGTGCAGGCACATGCAGAGG - Intronic
1163534933 19:17871750-17871772 GTGGGTGCATGGGGATGGAGGGG + Intergenic
1164942165 19:32259135-32259157 GGGTGTGCATGCTTAAGGAGTGG - Intergenic
1165203303 19:34162934-34162956 TGGGGTGCATGCACATTGAGTGG - Intergenic
926067728 2:9857748-9857770 GTGTGAGCAAGCCCATGCAGGGG + Intronic
927917106 2:26944387-26944409 GTGTGTGCATGCATGTGTATGGG - Intronic
928924663 2:36565524-36565546 GTGTGTGCCACCACTTGGAGGGG - Intronic
929457298 2:42075039-42075061 GTGTGGGGGAGCACATGGAGGGG - Intergenic
930710477 2:54546421-54546443 GTGTGTGTATGCACATATACAGG - Intronic
931134611 2:59383647-59383669 GTGTTTGCTTTCACAGGGAGAGG + Intergenic
931473807 2:62567771-62567793 GTGTGCGCATGCATGTGGTGAGG + Intergenic
931796492 2:65715095-65715117 TTGGATGCATGCTCATGGAGAGG + Intergenic
931806659 2:65813877-65813899 GTGTGTGCATGTACATATATAGG + Intergenic
934053893 2:88235527-88235549 GTGGCTGCATTCACATGGTGGGG + Intergenic
935322455 2:101902266-101902288 GGATGCACATGCACATGGAGAGG + Intergenic
936237810 2:110759559-110759581 GTGTGTCTTTGCACATGGATAGG + Intronic
936248177 2:110846528-110846550 TTGTTTGCATGCATATGCAGTGG + Intronic
936427566 2:112434134-112434156 GTGTGTGGATGCAGATGGGATGG - Intronic
937018832 2:118632382-118632404 GCGTGTGCACACACATGGACTGG + Intergenic
937090745 2:119204802-119204824 GTGTGGCCCTGCACAAGGAGTGG + Intergenic
937150945 2:119685217-119685239 GTGTGTGCCTGCAAAGGGGGGGG - Intronic
937804392 2:126121423-126121445 GTGTGTGCAAGCAAGTGTAGGGG - Intergenic
937908856 2:127065643-127065665 GTGGCTGCATCCTCATGGAGAGG - Intronic
939758204 2:146139294-146139316 GTGTGTGCATGCATATGCACAGG + Intergenic
940405055 2:153291892-153291914 GTCTTTGCATGCACGTGCAGTGG + Intergenic
940684820 2:156834335-156834357 GTGTGTGCATGCACAAAAATAGG - Intergenic
941547057 2:166864660-166864682 GTGTGTGCATGCACATTTTGGGG + Intergenic
941840709 2:170080646-170080668 GTATTTGGATGCTCATGGAGAGG + Exonic
941981129 2:171458396-171458418 GGGTGTGCATGCAGATGGGGTGG + Exonic
942624829 2:177888829-177888851 GTATGGGCATGCACATGCACTGG - Intronic
942865560 2:180670126-180670148 GTGTGTGCATGCACAGAGAGAGG + Intergenic
943736202 2:191357810-191357832 GTTGGTGCATGCACATTTAGGGG + Intronic
944094565 2:195951818-195951840 GTGTGTGCCTGCACATGAGATGG + Intronic
944859202 2:203798590-203798612 GTTTATGCTTGCACATGGTGAGG + Intergenic
945502068 2:210588721-210588743 GTGTGTGTATGTGTATGGAGGGG - Intronic
947731035 2:232431806-232431828 TTGTGTGTATGCACAGGGGGCGG - Intergenic
948253645 2:236550855-236550877 GTGTGTGAATGCACATGACACGG - Intergenic
948295275 2:236855951-236855973 AAGTGTGGATGCACATGGTGTGG - Intergenic
1169166907 20:3431915-3431937 GTGTCTGGATGAACAAGGAGAGG + Intergenic
1170169379 20:13393784-13393806 GTGTCTGCATGGACATTGTGAGG - Intronic
1171249029 20:23634774-23634796 GTGTGTGCATGTAGACGGGGTGG - Intronic
1171266159 20:23773634-23773656 GTGTGTGCATGTAGGTGGGGTGG - Intergenic
1171824642 20:29883943-29883965 GTGTGCGTGTGCACATGGTGTGG - Intergenic
1173119388 20:40275014-40275036 GTGTGTGCATGTACATGCTTGGG + Intergenic
1173163217 20:40667764-40667786 GTGTGTGTGTGCATGTGGAGGGG + Intergenic
1173181997 20:40812819-40812841 GTGTGTGCATGCACAAGTGACGG - Intergenic
1173842710 20:46168565-46168587 GTGTGTGCATCCACATGATAGGG + Intergenic
1174132156 20:48352808-48352830 GTGTATGTATGCACATGGGCAGG - Intergenic
1176675552 21:9773959-9773981 GTGTGCTCAGGCACATGAAGGGG + Intergenic
1177902786 21:26937068-26937090 ATGTGTGCATGCACATGGCATGG + Intronic
1178741960 21:35209470-35209492 GAGGCTGCATGCACATGGAAGGG + Intronic
1179188290 21:39102164-39102186 GTGTGTGTGTGTAGATGGAGGGG - Intergenic
1179304514 21:40142109-40142131 GAGTGCCCAGGCACATGGAGGGG - Intronic
1181036281 22:20171346-20171368 TTGTGTTCATGGACTTGGAGGGG + Intergenic
1181429869 22:22872744-22872766 GTGTGTGTGTGCATATGGTGTGG + Intronic
1181435517 22:22908207-22908229 GGGTGTAGGTGCACATGGAGGGG - Intergenic
1181808288 22:25388521-25388543 GTGTGTGCATGCACACGTGTGGG + Intronic
1182053652 22:27332301-27332323 GAGTCTGCAGGCACAAGGAGAGG + Intergenic
1183369861 22:37426471-37426493 GTGTGTGTGTGGACATGGGGTGG - Intronic
1184402816 22:44283680-44283702 GTATGTGCATGCAAAAGGTGCGG + Intronic
1185167596 22:49271231-49271253 GGGTGTGCAGGCACCTGGAAAGG + Intergenic
1185193826 22:49455732-49455754 CTGTGTGCGTTCACATGGGGTGG + Intronic
1185203243 22:49521381-49521403 ATGTGTGCAGCCACATGGGGTGG - Intronic
1203300551 22_KI270736v1_random:74056-74078 AGGTGTGCATTCAAATGGAGAGG + Intergenic
949399560 3:3651818-3651840 GTGTGACCATGGATATGGAGAGG - Intergenic
950495893 3:13334427-13334449 GTGTGTGCATGTGCAGGCAGGGG + Intronic
950759450 3:15207219-15207241 GTGTGTGCAGTTACATGCAGTGG + Intronic
951516344 3:23564171-23564193 GTGAGTGCATTCACATTTAGGGG + Intronic
951694632 3:25433501-25433523 GTGTGTGCGTGGACAGGGTGGGG + Intronic
952252041 3:31664796-31664818 GTGTGTGCATGCTTATAGTGCGG + Intronic
952492008 3:33882097-33882119 GTGTGTGCTTTCATGTGGAGTGG + Intergenic
953044340 3:39281503-39281525 GTGTGCTCATGAACACGGAGGGG - Intronic
953160583 3:40415857-40415879 GTGGGTGCACCCGCATGGAGTGG + Exonic
953221442 3:40975411-40975433 GTGTGTGCATGCACAAGTCCTGG - Intergenic
953881393 3:46693195-46693217 GTGTGTGCCTGGGCAGGGAGAGG - Intronic
954144111 3:48625866-48625888 TTGTGTGTGTGTACATGGAGGGG + Exonic
954796409 3:53163411-53163433 ATGTGGGTGTGCACATGGAGAGG + Intronic
955151472 3:56371555-56371577 GTGTGTGCATGCATGTGGTTGGG - Intronic
957556836 3:81773168-81773190 GTGTGTGCATGTAGGTGGATGGG + Intergenic
957972683 3:87403413-87403435 GTGTGTGTCTGCACATGGGATGG - Intergenic
958466214 3:94462374-94462396 GTGTGTGCATGCTGGGGGAGAGG + Intergenic
958606552 3:96364960-96364982 GTGTGTGCAGGCACTAGCAGTGG - Intergenic
959111401 3:102127186-102127208 GTGTATGCATGCACATCCATAGG - Intronic
959309088 3:104708573-104708595 GTGTGTGCGTGCATATGTGGAGG - Intergenic
961282542 3:125775212-125775234 GTGTCTGCAAGCACAAGAAGTGG + Intergenic
961867734 3:129966172-129966194 GTATGTGTATGCACATGCATGGG - Intergenic
961953143 3:130771623-130771645 TTTTGTGGATGCACATGGAAGGG - Intergenic
962304899 3:134277495-134277517 GTGTGTGCATGCACACGCACAGG + Intergenic
963750621 3:149175685-149175707 GTGTGTACCTACACATGGGGAGG + Intronic
963922699 3:150921388-150921410 GTGTGTGCGTGCACATGCAGGGG - Intronic
963994177 3:151687543-151687565 GCGTATGCATGCACATTAAGAGG - Intergenic
964836389 3:160942771-160942793 ATGTTTATATGCACATGGAGGGG - Intronic
965024455 3:163282555-163282577 GTGTGTGGAGGCACATGAATTGG + Intergenic
965132474 3:164719047-164719069 GTGTGTGCATGCATCTGTTGTGG + Intergenic
965180825 3:165401199-165401221 GTGTGTGCATGCAAATGTGTGGG + Intergenic
965350319 3:167603902-167603924 GTGTGTGCATGCACTGGTAGTGG + Intronic
966161277 3:176971299-176971321 GTGTGTGCATGCACGTGCTTCGG + Intergenic
966291737 3:178367388-178367410 GAGTGTGCTTGCACACAGAGGGG + Intergenic
966413139 3:179663807-179663829 GCATGAGCAAGCACATGGAGGGG - Intronic
970436599 4:16041627-16041649 GTGGGGGCATGCACCTGTAGTGG + Intronic
971484890 4:27148987-27149009 GTGCGTGCATGCACATTTATTGG + Intergenic
975636070 4:76449993-76450015 GTGTGTGTGAGCACAGGGAGGGG + Intronic
975661888 4:76696643-76696665 ATGTGTGAATGCCCATTGAGGGG + Intronic
976334297 4:83867879-83867901 GTGTGTGCATGCACAGTTGGAGG + Intergenic
976895579 4:90106724-90106746 GTGTGTGTATGTATATGGAGTGG - Intergenic
977384965 4:96327161-96327183 GGGTGTTCATGGACATGGAAAGG + Intergenic
977644889 4:99401536-99401558 ATGCTTCCATGCACATGGAGTGG - Intergenic
977845233 4:101759878-101759900 GTGTGCACACGCACATGCAGGGG + Intronic
978708536 4:111747844-111747866 ATGTGTGCATACACATGTATTGG + Intergenic
979083742 4:116378945-116378967 GAGTGTGCATGTGCAGGGAGTGG + Intergenic
979774679 4:124574890-124574912 GTGTGTGTGTGCATGTGGAGAGG - Intergenic
980011635 4:127601872-127601894 GTGTATGCATGCTCATGGACAGG - Intergenic
980091322 4:128445964-128445986 GAGTGCGCATGCACATGCACGGG + Intergenic
980739841 4:136935829-136935851 GTGTGTGTATGCGTGTGGAGGGG - Intergenic
980925441 4:139132434-139132456 GTGTGTGCATGCACATGTGGTGG - Intronic
983455500 4:167958179-167958201 GTGTGTGCATGTGCAAGGATGGG - Intergenic
984235172 4:177148017-177148039 ATGTGTGTATGCATCTGGAGGGG - Intergenic
985090625 4:186359304-186359326 GTTTGTGCATAGACAAGGAGAGG + Intergenic
985369717 4:189273113-189273135 GTGTGTGTGTGCACATGGTGTGG - Intergenic
985399991 4:189584738-189584760 GTGTGCGCAGGCACATGAAGGGG - Intergenic
985674235 5:1222072-1222094 GTGTGTGCATGTACATGCATGGG + Exonic
986130109 5:4922286-4922308 ATGCGTGCATGCACATGTACAGG + Intergenic
986309868 5:6543970-6543992 GTGTGTGTGTAAACATGGAGTGG - Intergenic
986324606 5:6662581-6662603 GTGTGTGTATTCACATAGACAGG + Intronic
986388478 5:7263192-7263214 TTGTTTGCATGCACATGAAAAGG - Intergenic
987243093 5:16021118-16021140 GTGGGGGCAGGCACAAGGAGGGG - Intergenic
987827206 5:23047536-23047558 TTGTGTGCATGCATGTGAAGAGG + Intergenic
987951392 5:24681592-24681614 GTGTGTGTATGTGTATGGAGGGG + Intergenic
990304732 5:54482789-54482811 GTGGGTGCCAGCACTTGGAGAGG + Intergenic
990978257 5:61578069-61578091 GTGTGTGCATACACATGTTGGGG - Intergenic
991493977 5:67210081-67210103 GCATGTGCTGGCACATGGAGAGG - Intergenic
992499947 5:77332082-77332104 CTGTGTGCCTGCAAATGGAAAGG + Intronic
992744658 5:79807286-79807308 GTGTGTGCATTCATGTGGGGAGG + Intergenic
992992837 5:82302565-82302587 GTGTTTGTATGCATATAGAGAGG + Intronic
993358649 5:86946093-86946115 GTGTGTGCATGCATATGAAGTGG - Intergenic
993592834 5:89816255-89816277 GTGTGTGTATGTACATGATGTGG + Intergenic
994591866 5:101783812-101783834 CTGTCTGCATTCGCATGGAGTGG + Intergenic
995159655 5:108964263-108964285 GTGTGTGTATGTGCATAGAGAGG + Intronic
997299653 5:132793324-132793346 GTCTCTGCATGCAGAGGGAGGGG - Intronic
998148611 5:139744631-139744653 GTGTGTACACACACATGGGGAGG - Intergenic
999153753 5:149443577-149443599 GTGTGTGCGAGCATATGGAGGGG - Intergenic
999879605 5:155847125-155847147 GTTTGTGTATGCACATGAATGGG + Intergenic
1000401746 5:160836048-160836070 GTGTTCGCATGGACATAGAGTGG + Intronic
1000756112 5:165162136-165162158 GTGTGTCTATGTACATGAAGGGG - Intergenic
1000992172 5:167922559-167922581 ATGTGTGCAAGCACAGAGAGAGG - Intronic
1001550152 5:172596675-172596697 GTGTGTGCATACATGTGGGGGGG - Intergenic
1002106548 5:176882036-176882058 GCATGTGCATCAACATGGAGTGG - Exonic
1003165666 6:3676095-3676117 GTGTGTCTTTGCACATGGATGGG + Intergenic
1004135596 6:12962973-12962995 GTGTGTGCATGCATGTGCTGAGG - Intronic
1004746472 6:18513839-18513861 GTTTGAGCCTGCACATGGACGGG + Intergenic
1004770806 6:18779093-18779115 GTGTGTGCATGCACGTGTATTGG + Intergenic
1005091327 6:22059914-22059936 GTGTGTGTATGCACATGCATGGG + Intergenic
1007409869 6:41655258-41655280 GTGTGTGCGTGGAGATGGAGTGG - Intergenic
1007574600 6:42916748-42916770 ATGTGTGCATGTACGTGGTGGGG + Intronic
1008367556 6:50699936-50699958 GTGTGTGTGTGCATATGGTGGGG + Intergenic
1008892809 6:56514612-56514634 GTGTGTGTATGCGCATGAGGGGG - Intronic
1010373742 6:75141745-75141767 GTGTGTGCATGTATGTGTAGTGG - Intronic
1011719362 6:90139418-90139440 CTGTGTGCATGCACAGTGACTGG + Intronic
1012999959 6:106012102-106012124 GTGTGTGTATGAATGTGGAGGGG - Intergenic
1013193506 6:107824889-107824911 GTGTGTGCACACACCTGGATAGG - Intergenic
1013297030 6:108766834-108766856 CTGTGTGCAGGCATATGCAGAGG - Intergenic
1014189915 6:118483420-118483442 GTGTGTGCATGCATGTGTATGGG + Intronic
1015408859 6:132869097-132869119 GTGTGTGCATAAATATTGAGAGG - Intergenic
1016669024 6:146679363-146679385 GTGTGTGCATGTACATGACTTGG - Intronic
1017581899 6:155874271-155874293 GTGTGTGCATGCAAATGTGTAGG - Intergenic
1017973983 6:159338224-159338246 GTGTGTGCAGGCACCTGCTGTGG - Intergenic
1018046843 6:159972771-159972793 CTGTGTCCGTGCACGTGGAGGGG + Intronic
1019115974 6:169763011-169763033 GTGTGTGTACACACATGGAGGGG - Intronic
1019203019 6:170334601-170334623 GTGTGTGCCTGCCCTTGGTGAGG + Intronic
1019352763 7:562631-562653 GTGTGACCAGGCAGATGGAGGGG - Intronic
1022297527 7:29069822-29069844 GTGTGTGCATGTAAATGCATAGG + Intronic
1023521430 7:41053742-41053764 GTGTGTGCCTGTACAAGGATGGG - Intergenic
1023776448 7:43612251-43612273 ATGTCTGACTGCACATGGAGGGG - Intronic
1024918832 7:54535428-54535450 GTGCATGCATGCACATGCACAGG - Intergenic
1024960746 7:54972029-54972051 GTGTGGGCATGCACTAGGGGAGG - Intergenic
1025018735 7:55464180-55464202 GTGTGTGCAGGCACTAGAAGTGG + Intronic
1026572017 7:71539489-71539511 GTGTGTGCGTGCACGTGTACAGG + Intronic
1027023239 7:74831490-74831512 GTGTGTGTATGTACAGAGAGAGG - Intronic
1027064690 7:75113810-75113832 GTGTGTGTATGTACAGAGAGAGG + Intronic
1029123639 7:98283623-98283645 GAGTGTGAAGGCACATGGAGGGG + Intronic
1029328060 7:99826772-99826794 GGGTATGCTTGCACTTGGAGGGG - Intergenic
1029591188 7:101508090-101508112 ATGTGAGCAGGCACAAGGAGTGG - Intronic
1030293035 7:107891156-107891178 GCCTGTGCATGCGCAGGGAGGGG + Exonic
1030981170 7:116186584-116186606 AGGTGTGCATGCACTTGGGGTGG - Intergenic
1031398335 7:121301108-121301130 CTGTGGGTATGCACATGTAGTGG - Intergenic
1032079524 7:128851815-128851837 GTGTTTTCAGGCACAAGGAGTGG - Intronic
1032389039 7:131543923-131543945 GTGTGTGGCTGCATATGCAGAGG - Intronic
1032709605 7:134450414-134450436 GTGTGTGCACGTGCCTGGAGGGG + Intronic
1032961257 7:137037161-137037183 ATTTGTATATGCACATGGAGAGG + Intergenic
1033385780 7:140873740-140873762 CTGTGTGCATGAACATGCAGAGG - Intronic
1034252244 7:149701745-149701767 GTGTATGCATGCACTTGGGGTGG - Intergenic
1034717054 7:153253102-153253124 GTGTGTGTAGGCACAGAGAGTGG - Intergenic
1034746932 7:153530853-153530875 GCGTGTGAATGAACATGGCGAGG - Intergenic
1035124909 7:156601541-156601563 GTGTGGGCATATTCATGGAGGGG - Intergenic
1037367174 8:18135444-18135466 GTGTGTGTGTGCTCATGGACTGG - Intergenic
1038059610 8:23898111-23898133 ATGTGTGGATGTATATGGAGAGG - Intergenic
1038375664 8:27037757-27037779 GTGTGTACATTTACCTGGAGGGG + Intergenic
1039466477 8:37788589-37788611 GTGCGTGCATGCACATGTTGGGG - Intronic
1040802647 8:51360294-51360316 GTGTAAGCATGCACATGTATGGG - Intronic
1042206670 8:66336404-66336426 GTGTGTGCATGCACGTGCCTTGG - Intergenic
1042311114 8:67380229-67380251 GTGTGTGCATGCACACAGACTGG - Intergenic
1043128279 8:76428088-76428110 GTGTGTGCATGCACAGATTGGGG - Intergenic
1043882321 8:85558715-85558737 AAGTGTGCAAGCACATGGAGTGG + Intergenic
1044179742 8:89176461-89176483 ATGTGTGCATGCATAAAGAGAGG + Intergenic
1044311085 8:90693353-90693375 GTGTGTGCACGCACATGTGTAGG + Intronic
1044795725 8:95895351-95895373 TTATGTGCATGCACATGTATAGG - Intergenic
1045652146 8:104351294-104351316 GTGTGTGTATGCACATGTATGGG + Intronic
1045710320 8:104975561-104975583 GTGTGCGCATGCACGTGCAGGGG - Intronic
1046792003 8:118332599-118332621 GTGTGTGCATGCAGAGGGCATGG + Intronic
1046984125 8:120368961-120368983 GTGTGTGCACGCCCATAGATTGG + Intronic
1047168242 8:122464321-122464343 GTGTGTGCGTGCACACACAGAGG - Intergenic
1047330152 8:123879708-123879730 GTGTGTGTATGCGCATGCACAGG - Intronic
1048560595 8:135532553-135532575 GTGTGTGTACACACACGGAGTGG + Intronic
1048964602 8:139606413-139606435 GTGTGTGCATGTGCATTGACCGG - Intronic
1049161283 8:141099535-141099557 GTGTGGGCAGGCACGGGGAGGGG + Intergenic
1049298856 8:141859145-141859167 GTGTGAGGACACACATGGAGAGG + Intergenic
1049429742 8:142555234-142555256 GTGTGGGCAGGCACGGGGAGGGG - Intergenic
1049525507 8:143124361-143124383 GTGTGTGCATGTACATGTGAGGG - Intergenic
1049531866 8:143159145-143159167 GTGTGTGCACGCACGTGCATGGG - Intronic
1049773258 8:144393397-144393419 GGGTGGGGATGCACACGGAGGGG + Intronic
1050263668 9:3867771-3867793 GCGTGTGCATGCACATGTGTTGG + Intronic
1050485880 9:6134247-6134269 GTGTGTGCATGCACGTGTGACGG + Intergenic
1050728623 9:8681550-8681572 GTGTGTGTATGGAGATGGGGAGG - Intronic
1053153013 9:35754715-35754737 GAGTGAGCAGGCACCTGGAGTGG + Exonic
1053748537 9:41229849-41229871 GTGCATGTGTGCACATGGAGTGG + Intergenic
1053930788 9:43112384-43112406 GTGTGTGCATGTGTAGGGAGGGG - Intergenic
1055079496 9:72255228-72255250 GTGGGTGGATGCAAATTGAGGGG + Intronic
1055494933 9:76844600-76844622 GTGTGTGTATGTATGTGGAGGGG - Intronic
1055956989 9:81783314-81783336 GTGTGTGTGTGGACGTGGAGGGG + Intergenic
1056450844 9:86715522-86715544 GTGTCTGCATGCATGGGGAGGGG + Intergenic
1058042464 9:100318594-100318616 GTGTGTGCATGTAAATTTAGGGG - Intronic
1058063160 9:100520846-100520868 TGTTGTGCATGCACATGTAGAGG + Intronic
1059962013 9:119574774-119574796 GTGTGTACACGCATATGAAGTGG - Intergenic
1060473928 9:123971083-123971105 GTGTGTGCATGCATCCGGTGGGG - Intergenic
1062010150 9:134262500-134262522 GTGTGAGCGTGCACATGTTGGGG - Intergenic
1062010154 9:134262536-134262558 GTGTGAGCACGCACATGTTGGGG - Intergenic
1062010163 9:134262644-134262666 GTGTGAGCGTGCACATGTTGGGG - Intergenic
1062049793 9:134441364-134441386 GTGTGTGCATGCGTATGAATGGG - Intergenic
1062294089 9:135814542-135814564 CAGTGTGCATGCCCAGGGAGGGG - Intronic
1203445506 Un_GL000219v1:50913-50935 GTGTGCGTGTGCACATGGTGTGG - Intergenic
1203445540 Un_GL000219v1:51194-51216 GTGTGTGTGTGCACATGGTGTGG - Intergenic
1203377869 Un_KI270442v1:391744-391766 GTGTGTGCATGTACACGGTGTGG - Intergenic
1186204794 X:7190031-7190053 GTTTTTGCATGGACAGGGAGGGG + Intergenic
1187292961 X:17973003-17973025 GGTTGTGCATGCAAATGGAGAGG + Intergenic
1187341346 X:18424888-18424910 GTGTGTGTGTGCACACGCAGCGG + Intergenic
1187401225 X:18962263-18962285 GTGCGTGCATGGGCATGGAGGGG + Intronic
1188363319 X:29283646-29283668 GTGTGTATGTGCACAGGGAGAGG + Intronic
1189798441 X:44669341-44669363 GTGTGTGTGTGCACATGCAGTGG + Intergenic
1189989463 X:46580498-46580520 ATGTGTGTGTGCACATGGATAGG + Intronic
1190057527 X:47190525-47190547 GTGGGTGCCTCCACATGGAAAGG - Intergenic
1190212366 X:48458887-48458909 CTGTGCGCATGCACATGGAGGGG - Exonic
1191067843 X:56368865-56368887 GTGTGTACATTCACAGGAAGTGG - Intergenic
1191672978 X:63766257-63766279 GTGTGTGTATGCACACTGAGAGG + Intronic
1191794784 X:65009705-65009727 GTGTATGGATGCACATGCAGTGG - Intronic
1193968003 X:88013270-88013292 GTCTGTTCATGCACTTGGATTGG + Intergenic
1195105916 X:101601169-101601191 TTGTGTGCACTCACCTGGAGGGG - Intergenic
1195106967 X:101612598-101612620 TTGTGTGCACTCACCTGGAGGGG + Intergenic
1195749323 X:108148503-108148525 GTGTGTGTATGTGCATGGAGTGG - Intronic
1195992434 X:110695945-110695967 TTGTTTTCATGCACATGGATAGG + Intronic
1196809381 X:119616608-119616630 GTGTGTGCTTGCAGTTTGAGGGG + Intronic
1199571767 X:149273651-149273673 CTGTGTGCGTGCAAATGGTGTGG + Intergenic
1200016944 X:153172184-153172206 CTCTGTGCATGTGCATGGAGAGG + Intergenic
1200323713 X:155216377-155216399 GAATGTGCATGGAGATGGAGAGG + Exonic
1200709171 Y:6468511-6468533 GTGTGTGCCTGTAAGTGGAGTGG - Intergenic
1201011968 Y:9556589-9556611 GTGTGTGTATGCACATGCACAGG + Intergenic
1201024941 Y:9696197-9696219 GTGTGTGCCTGTAAGTGGAGTGG + Intergenic
1201255701 Y:12106340-12106362 ATGTGTGCATGTACATGTACAGG + Intergenic