ID: 922024555

View in Genome Browser
Species Human (GRCh38)
Location 1:221738627-221738649
Sequence GGGGCTTTATACACACCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 115}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922024555_922024559 11 Left 922024555 1:221738627-221738649 CCATCTGGTGTGTATAAAGCCCC 0: 1
1: 0
2: 0
3: 1
4: 115
Right 922024559 1:221738661-221738683 ATGAGAAAACAGTCCCAGAGAGG 0: 1
1: 9
2: 63
3: 250
4: 914

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922024555 Original CRISPR GGGGCTTTATACACACCAGA TGG (reversed) Intronic