ID: 922024556

View in Genome Browser
Species Human (GRCh38)
Location 1:221738646-221738668
Sequence TTTCTCATCTTTCTAAAAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 659
Summary {0: 1, 1: 0, 2: 8, 3: 64, 4: 586}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922024556_922024559 -8 Left 922024556 1:221738646-221738668 CCCCTTTTTAGAAAGATGAGAAA 0: 1
1: 0
2: 8
3: 64
4: 586
Right 922024559 1:221738661-221738683 ATGAGAAAACAGTCCCAGAGAGG 0: 1
1: 9
2: 63
3: 250
4: 914

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922024556 Original CRISPR TTTCTCATCTTTCTAAAAAG GGG (reversed) Intronic