ID: 922024557

View in Genome Browser
Species Human (GRCh38)
Location 1:221738647-221738669
Sequence TTTTCTCATCTTTCTAAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1209
Summary {0: 1, 1: 0, 2: 7, 3: 120, 4: 1081}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922024557_922024559 -9 Left 922024557 1:221738647-221738669 CCCTTTTTAGAAAGATGAGAAAA 0: 1
1: 0
2: 7
3: 120
4: 1081
Right 922024559 1:221738661-221738683 ATGAGAAAACAGTCCCAGAGAGG 0: 1
1: 9
2: 63
3: 250
4: 914

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922024557 Original CRISPR TTTTCTCATCTTTCTAAAAA GGG (reversed) Intronic