ID: 922024558 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:221738648-221738670 |
| Sequence | GTTTTCTCATCTTTCTAAAA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 1170 | |||
| Summary | {0: 1, 1: 0, 2: 11, 3: 114, 4: 1044} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 922024558_922024559 | -10 | Left | 922024558 | 1:221738648-221738670 | CCTTTTTAGAAAGATGAGAAAAC | 0: 1 1: 0 2: 11 3: 114 4: 1044 |
||
| Right | 922024559 | 1:221738661-221738683 | ATGAGAAAACAGTCCCAGAGAGG | 0: 1 1: 9 2: 63 3: 250 4: 914 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 922024558 | Original CRISPR | GTTTTCTCATCTTTCTAAAA AGG (reversed) | Intronic | ||