ID: 922024558

View in Genome Browser
Species Human (GRCh38)
Location 1:221738648-221738670
Sequence GTTTTCTCATCTTTCTAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1170
Summary {0: 1, 1: 0, 2: 11, 3: 114, 4: 1044}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922024558_922024559 -10 Left 922024558 1:221738648-221738670 CCTTTTTAGAAAGATGAGAAAAC 0: 1
1: 0
2: 11
3: 114
4: 1044
Right 922024559 1:221738661-221738683 ATGAGAAAACAGTCCCAGAGAGG 0: 1
1: 9
2: 63
3: 250
4: 914

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922024558 Original CRISPR GTTTTCTCATCTTTCTAAAA AGG (reversed) Intronic