ID: 922024559

View in Genome Browser
Species Human (GRCh38)
Location 1:221738661-221738683
Sequence ATGAGAAAACAGTCCCAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1237
Summary {0: 1, 1: 9, 2: 63, 3: 250, 4: 914}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922024556_922024559 -8 Left 922024556 1:221738646-221738668 CCCCTTTTTAGAAAGATGAGAAA 0: 1
1: 0
2: 8
3: 64
4: 586
Right 922024559 1:221738661-221738683 ATGAGAAAACAGTCCCAGAGAGG 0: 1
1: 9
2: 63
3: 250
4: 914
922024558_922024559 -10 Left 922024558 1:221738648-221738670 CCTTTTTAGAAAGATGAGAAAAC 0: 1
1: 0
2: 11
3: 114
4: 1044
Right 922024559 1:221738661-221738683 ATGAGAAAACAGTCCCAGAGAGG 0: 1
1: 9
2: 63
3: 250
4: 914
922024557_922024559 -9 Left 922024557 1:221738647-221738669 CCCTTTTTAGAAAGATGAGAAAA 0: 1
1: 0
2: 7
3: 120
4: 1081
Right 922024559 1:221738661-221738683 ATGAGAAAACAGTCCCAGAGAGG 0: 1
1: 9
2: 63
3: 250
4: 914
922024555_922024559 11 Left 922024555 1:221738627-221738649 CCATCTGGTGTGTATAAAGCCCC 0: 1
1: 0
2: 0
3: 1
4: 115
Right 922024559 1:221738661-221738683 ATGAGAAAACAGTCCCAGAGAGG 0: 1
1: 9
2: 63
3: 250
4: 914
922024553_922024559 30 Left 922024553 1:221738608-221738630 CCAGGCATGACTTGAGATACCAT 0: 1
1: 0
2: 0
3: 6
4: 93
Right 922024559 1:221738661-221738683 ATGAGAAAACAGTCCCAGAGAGG 0: 1
1: 9
2: 63
3: 250
4: 914

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922024559 Original CRISPR ATGAGAAAACAGTCCCAGAG AGG Intronic