ID: 922027412

View in Genome Browser
Species Human (GRCh38)
Location 1:221763697-221763719
Sequence GTGAACACTGTGTCCTCACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922027404_922027412 27 Left 922027404 1:221763647-221763669 CCAGTCTCTCCTTCCAAGATGGC 0: 4
1: 15
2: 59
3: 129
4: 374
Right 922027412 1:221763697-221763719 GTGAACACTGTGTCCTCACATGG No data
922027406_922027412 14 Left 922027406 1:221763660-221763682 CCAAGATGGCACCTTGTTGCTGT 0: 13
1: 71
2: 186
3: 312
4: 608
Right 922027412 1:221763697-221763719 GTGAACACTGTGTCCTCACATGG No data
922027402_922027412 28 Left 922027402 1:221763646-221763668 CCCAGTCTCTCCTTCCAAGATGG 0: 4
1: 22
2: 96
3: 180
4: 394
Right 922027412 1:221763697-221763719 GTGAACACTGTGTCCTCACATGG No data
922027407_922027412 3 Left 922027407 1:221763671-221763693 CCTTGTTGCTGTATCCTCCAGAG No data
Right 922027412 1:221763697-221763719 GTGAACACTGTGTCCTCACATGG No data
922027405_922027412 18 Left 922027405 1:221763656-221763678 CCTTCCAAGATGGCACCTTGTTG 0: 5
1: 4
2: 12
3: 31
4: 151
Right 922027412 1:221763697-221763719 GTGAACACTGTGTCCTCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922027412 Original CRISPR GTGAACACTGTGTCCTCACA TGG Intergenic
No off target data available for this crispr