ID: 922031954

View in Genome Browser
Species Human (GRCh38)
Location 1:221809960-221809982
Sequence GAAAGTTAAGAAGGCTTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922031954_922031969 28 Left 922031954 1:221809960-221809982 CCTCCAAAGCCTTCTTAACTTTC No data
Right 922031969 1:221810011-221810033 GGAGGCCCTTCATTCCCAAGGGG No data
922031954_922031962 10 Left 922031954 1:221809960-221809982 CCTCCAAAGCCTTCTTAACTTTC No data
Right 922031962 1:221809993-221810015 GGCCTAAGGCCCATCCAAGGAGG No data
922031954_922031959 -4 Left 922031954 1:221809960-221809982 CCTCCAAAGCCTTCTTAACTTTC No data
Right 922031959 1:221809979-221810001 TTTCTGAGAGCCTGGGCCTAAGG No data
922031954_922031961 7 Left 922031954 1:221809960-221809982 CCTCCAAAGCCTTCTTAACTTTC No data
Right 922031961 1:221809990-221810012 CTGGGCCTAAGGCCCATCCAAGG No data
922031954_922031967 26 Left 922031954 1:221809960-221809982 CCTCCAAAGCCTTCTTAACTTTC No data
Right 922031967 1:221810009-221810031 AAGGAGGCCCTTCATTCCCAAGG No data
922031954_922031968 27 Left 922031954 1:221809960-221809982 CCTCCAAAGCCTTCTTAACTTTC No data
Right 922031968 1:221810010-221810032 AGGAGGCCCTTCATTCCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922031954 Original CRISPR GAAAGTTAAGAAGGCTTTGG AGG (reversed) Intergenic
No off target data available for this crispr