ID: 922031955

View in Genome Browser
Species Human (GRCh38)
Location 1:221809963-221809985
Sequence TCAGAAAGTTAAGAAGGCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922031955_922031971 30 Left 922031955 1:221809963-221809985 CCAAAGCCTTCTTAACTTTCTGA No data
Right 922031971 1:221810016-221810038 CCCTTCATTCCCAAGGGGAAAGG No data
922031955_922031961 4 Left 922031955 1:221809963-221809985 CCAAAGCCTTCTTAACTTTCTGA No data
Right 922031961 1:221809990-221810012 CTGGGCCTAAGGCCCATCCAAGG No data
922031955_922031968 24 Left 922031955 1:221809963-221809985 CCAAAGCCTTCTTAACTTTCTGA No data
Right 922031968 1:221810010-221810032 AGGAGGCCCTTCATTCCCAAGGG No data
922031955_922031967 23 Left 922031955 1:221809963-221809985 CCAAAGCCTTCTTAACTTTCTGA No data
Right 922031967 1:221810009-221810031 AAGGAGGCCCTTCATTCCCAAGG No data
922031955_922031962 7 Left 922031955 1:221809963-221809985 CCAAAGCCTTCTTAACTTTCTGA No data
Right 922031962 1:221809993-221810015 GGCCTAAGGCCCATCCAAGGAGG No data
922031955_922031959 -7 Left 922031955 1:221809963-221809985 CCAAAGCCTTCTTAACTTTCTGA No data
Right 922031959 1:221809979-221810001 TTTCTGAGAGCCTGGGCCTAAGG No data
922031955_922031969 25 Left 922031955 1:221809963-221809985 CCAAAGCCTTCTTAACTTTCTGA No data
Right 922031969 1:221810011-221810033 GGAGGCCCTTCATTCCCAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922031955 Original CRISPR TCAGAAAGTTAAGAAGGCTT TGG (reversed) Intergenic
No off target data available for this crispr