ID: 922031956

View in Genome Browser
Species Human (GRCh38)
Location 1:221809969-221809991
Sequence AGGCTCTCAGAAAGTTAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922031956_922031969 19 Left 922031956 1:221809969-221809991 CCTTCTTAACTTTCTGAGAGCCT No data
Right 922031969 1:221810011-221810033 GGAGGCCCTTCATTCCCAAGGGG No data
922031956_922031961 -2 Left 922031956 1:221809969-221809991 CCTTCTTAACTTTCTGAGAGCCT No data
Right 922031961 1:221809990-221810012 CTGGGCCTAAGGCCCATCCAAGG No data
922031956_922031975 27 Left 922031956 1:221809969-221809991 CCTTCTTAACTTTCTGAGAGCCT No data
Right 922031975 1:221810019-221810041 TTCATTCCCAAGGGGAAAGGGGG No data
922031956_922031967 17 Left 922031956 1:221809969-221809991 CCTTCTTAACTTTCTGAGAGCCT No data
Right 922031967 1:221810009-221810031 AAGGAGGCCCTTCATTCCCAAGG No data
922031956_922031962 1 Left 922031956 1:221809969-221809991 CCTTCTTAACTTTCTGAGAGCCT No data
Right 922031962 1:221809993-221810015 GGCCTAAGGCCCATCCAAGGAGG No data
922031956_922031968 18 Left 922031956 1:221809969-221809991 CCTTCTTAACTTTCTGAGAGCCT No data
Right 922031968 1:221810010-221810032 AGGAGGCCCTTCATTCCCAAGGG No data
922031956_922031971 24 Left 922031956 1:221809969-221809991 CCTTCTTAACTTTCTGAGAGCCT No data
Right 922031971 1:221810016-221810038 CCCTTCATTCCCAAGGGGAAAGG No data
922031956_922031976 30 Left 922031956 1:221809969-221809991 CCTTCTTAACTTTCTGAGAGCCT No data
Right 922031976 1:221810022-221810044 ATTCCCAAGGGGAAAGGGGGTGG No data
922031956_922031973 25 Left 922031956 1:221809969-221809991 CCTTCTTAACTTTCTGAGAGCCT No data
Right 922031973 1:221810017-221810039 CCTTCATTCCCAAGGGGAAAGGG No data
922031956_922031974 26 Left 922031956 1:221809969-221809991 CCTTCTTAACTTTCTGAGAGCCT No data
Right 922031974 1:221810018-221810040 CTTCATTCCCAAGGGGAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922031956 Original CRISPR AGGCTCTCAGAAAGTTAAGA AGG (reversed) Intergenic
No off target data available for this crispr