ID: 922031960

View in Genome Browser
Species Human (GRCh38)
Location 1:221809989-221810011
Sequence CTTGGATGGGCCTTAGGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922031960_922031967 -3 Left 922031960 1:221809989-221810011 CCTGGGCCTAAGGCCCATCCAAG No data
Right 922031967 1:221810009-221810031 AAGGAGGCCCTTCATTCCCAAGG No data
922031960_922031976 10 Left 922031960 1:221809989-221810011 CCTGGGCCTAAGGCCCATCCAAG No data
Right 922031976 1:221810022-221810044 ATTCCCAAGGGGAAAGGGGGTGG No data
922031960_922031974 6 Left 922031960 1:221809989-221810011 CCTGGGCCTAAGGCCCATCCAAG No data
Right 922031974 1:221810018-221810040 CTTCATTCCCAAGGGGAAAGGGG No data
922031960_922031973 5 Left 922031960 1:221809989-221810011 CCTGGGCCTAAGGCCCATCCAAG No data
Right 922031973 1:221810017-221810039 CCTTCATTCCCAAGGGGAAAGGG No data
922031960_922031968 -2 Left 922031960 1:221809989-221810011 CCTGGGCCTAAGGCCCATCCAAG No data
Right 922031968 1:221810010-221810032 AGGAGGCCCTTCATTCCCAAGGG No data
922031960_922031975 7 Left 922031960 1:221809989-221810011 CCTGGGCCTAAGGCCCATCCAAG No data
Right 922031975 1:221810019-221810041 TTCATTCCCAAGGGGAAAGGGGG No data
922031960_922031971 4 Left 922031960 1:221809989-221810011 CCTGGGCCTAAGGCCCATCCAAG No data
Right 922031971 1:221810016-221810038 CCCTTCATTCCCAAGGGGAAAGG No data
922031960_922031969 -1 Left 922031960 1:221809989-221810011 CCTGGGCCTAAGGCCCATCCAAG No data
Right 922031969 1:221810011-221810033 GGAGGCCCTTCATTCCCAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922031960 Original CRISPR CTTGGATGGGCCTTAGGCCC AGG (reversed) Intergenic
No off target data available for this crispr