ID: 922031964

View in Genome Browser
Species Human (GRCh38)
Location 1:221810002-221810024
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922031964_922031974 -7 Left 922031964 1:221810002-221810024 CCCATCCAAGGAGGCCCTTCATT No data
Right 922031974 1:221810018-221810040 CTTCATTCCCAAGGGGAAAGGGG No data
922031964_922031976 -3 Left 922031964 1:221810002-221810024 CCCATCCAAGGAGGCCCTTCATT No data
Right 922031976 1:221810022-221810044 ATTCCCAAGGGGAAAGGGGGTGG No data
922031964_922031973 -8 Left 922031964 1:221810002-221810024 CCCATCCAAGGAGGCCCTTCATT No data
Right 922031973 1:221810017-221810039 CCTTCATTCCCAAGGGGAAAGGG No data
922031964_922031971 -9 Left 922031964 1:221810002-221810024 CCCATCCAAGGAGGCCCTTCATT No data
Right 922031971 1:221810016-221810038 CCCTTCATTCCCAAGGGGAAAGG No data
922031964_922031975 -6 Left 922031964 1:221810002-221810024 CCCATCCAAGGAGGCCCTTCATT No data
Right 922031975 1:221810019-221810041 TTCATTCCCAAGGGGAAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922031964 Original CRISPR AATGAAGGGCCTCCTTGGAT GGG (reversed) Intergenic
No off target data available for this crispr