ID: 922031966

View in Genome Browser
Species Human (GRCh38)
Location 1:221810007-221810029
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922031966_922031976 -8 Left 922031966 1:221810007-221810029 CCAAGGAGGCCCTTCATTCCCAA No data
Right 922031976 1:221810022-221810044 ATTCCCAAGGGGAAAGGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922031966 Original CRISPR TTGGGAATGAAGGGCCTCCT TGG (reversed) Intergenic
No off target data available for this crispr