ID: 922031967

View in Genome Browser
Species Human (GRCh38)
Location 1:221810009-221810031
Sequence AAGGAGGCCCTTCATTCCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922031954_922031967 26 Left 922031954 1:221809960-221809982 CCTCCAAAGCCTTCTTAACTTTC No data
Right 922031967 1:221810009-221810031 AAGGAGGCCCTTCATTCCCAAGG No data
922031963_922031967 -9 Left 922031963 1:221809995-221810017 CCTAAGGCCCATCCAAGGAGGCC No data
Right 922031967 1:221810009-221810031 AAGGAGGCCCTTCATTCCCAAGG No data
922031955_922031967 23 Left 922031955 1:221809963-221809985 CCAAAGCCTTCTTAACTTTCTGA No data
Right 922031967 1:221810009-221810031 AAGGAGGCCCTTCATTCCCAAGG No data
922031956_922031967 17 Left 922031956 1:221809969-221809991 CCTTCTTAACTTTCTGAGAGCCT No data
Right 922031967 1:221810009-221810031 AAGGAGGCCCTTCATTCCCAAGG No data
922031960_922031967 -3 Left 922031960 1:221809989-221810011 CCTGGGCCTAAGGCCCATCCAAG No data
Right 922031967 1:221810009-221810031 AAGGAGGCCCTTCATTCCCAAGG No data
922031953_922031967 27 Left 922031953 1:221809959-221809981 CCCTCCAAAGCCTTCTTAACTTT No data
Right 922031967 1:221810009-221810031 AAGGAGGCCCTTCATTCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922031967 Original CRISPR AAGGAGGCCCTTCATTCCCA AGG Intergenic
No off target data available for this crispr