ID: 922031969

View in Genome Browser
Species Human (GRCh38)
Location 1:221810011-221810033
Sequence GGAGGCCCTTCATTCCCAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922031963_922031969 -7 Left 922031963 1:221809995-221810017 CCTAAGGCCCATCCAAGGAGGCC No data
Right 922031969 1:221810011-221810033 GGAGGCCCTTCATTCCCAAGGGG No data
922031953_922031969 29 Left 922031953 1:221809959-221809981 CCCTCCAAAGCCTTCTTAACTTT No data
Right 922031969 1:221810011-221810033 GGAGGCCCTTCATTCCCAAGGGG No data
922031956_922031969 19 Left 922031956 1:221809969-221809991 CCTTCTTAACTTTCTGAGAGCCT No data
Right 922031969 1:221810011-221810033 GGAGGCCCTTCATTCCCAAGGGG No data
922031954_922031969 28 Left 922031954 1:221809960-221809982 CCTCCAAAGCCTTCTTAACTTTC No data
Right 922031969 1:221810011-221810033 GGAGGCCCTTCATTCCCAAGGGG No data
922031960_922031969 -1 Left 922031960 1:221809989-221810011 CCTGGGCCTAAGGCCCATCCAAG No data
Right 922031969 1:221810011-221810033 GGAGGCCCTTCATTCCCAAGGGG No data
922031955_922031969 25 Left 922031955 1:221809963-221809985 CCAAAGCCTTCTTAACTTTCTGA No data
Right 922031969 1:221810011-221810033 GGAGGCCCTTCATTCCCAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922031969 Original CRISPR GGAGGCCCTTCATTCCCAAG GGG Intergenic
No off target data available for this crispr