ID: 922031971

View in Genome Browser
Species Human (GRCh38)
Location 1:221810016-221810038
Sequence CCCTTCATTCCCAAGGGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922031964_922031971 -9 Left 922031964 1:221810002-221810024 CCCATCCAAGGAGGCCCTTCATT No data
Right 922031971 1:221810016-221810038 CCCTTCATTCCCAAGGGGAAAGG No data
922031955_922031971 30 Left 922031955 1:221809963-221809985 CCAAAGCCTTCTTAACTTTCTGA No data
Right 922031971 1:221810016-221810038 CCCTTCATTCCCAAGGGGAAAGG No data
922031965_922031971 -10 Left 922031965 1:221810003-221810025 CCATCCAAGGAGGCCCTTCATTC No data
Right 922031971 1:221810016-221810038 CCCTTCATTCCCAAGGGGAAAGG No data
922031960_922031971 4 Left 922031960 1:221809989-221810011 CCTGGGCCTAAGGCCCATCCAAG No data
Right 922031971 1:221810016-221810038 CCCTTCATTCCCAAGGGGAAAGG No data
922031956_922031971 24 Left 922031956 1:221809969-221809991 CCTTCTTAACTTTCTGAGAGCCT No data
Right 922031971 1:221810016-221810038 CCCTTCATTCCCAAGGGGAAAGG No data
922031963_922031971 -2 Left 922031963 1:221809995-221810017 CCTAAGGCCCATCCAAGGAGGCC No data
Right 922031971 1:221810016-221810038 CCCTTCATTCCCAAGGGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922031971 Original CRISPR CCCTTCATTCCCAAGGGGAA AGG Intergenic
No off target data available for this crispr