ID: 922031974

View in Genome Browser
Species Human (GRCh38)
Location 1:221810018-221810040
Sequence CTTCATTCCCAAGGGGAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922031964_922031974 -7 Left 922031964 1:221810002-221810024 CCCATCCAAGGAGGCCCTTCATT No data
Right 922031974 1:221810018-221810040 CTTCATTCCCAAGGGGAAAGGGG No data
922031960_922031974 6 Left 922031960 1:221809989-221810011 CCTGGGCCTAAGGCCCATCCAAG No data
Right 922031974 1:221810018-221810040 CTTCATTCCCAAGGGGAAAGGGG No data
922031965_922031974 -8 Left 922031965 1:221810003-221810025 CCATCCAAGGAGGCCCTTCATTC No data
Right 922031974 1:221810018-221810040 CTTCATTCCCAAGGGGAAAGGGG No data
922031956_922031974 26 Left 922031956 1:221809969-221809991 CCTTCTTAACTTTCTGAGAGCCT No data
Right 922031974 1:221810018-221810040 CTTCATTCCCAAGGGGAAAGGGG No data
922031963_922031974 0 Left 922031963 1:221809995-221810017 CCTAAGGCCCATCCAAGGAGGCC No data
Right 922031974 1:221810018-221810040 CTTCATTCCCAAGGGGAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922031974 Original CRISPR CTTCATTCCCAAGGGGAAAG GGG Intergenic
No off target data available for this crispr