ID: 922032914

View in Genome Browser
Species Human (GRCh38)
Location 1:221821603-221821625
Sequence TCTTATGTAGTGAAGGTACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922032911_922032914 0 Left 922032911 1:221821580-221821602 CCATCTCCAGAGACTTGTTTGTC No data
Right 922032914 1:221821603-221821625 TCTTATGTAGTGAAGGTACCTGG No data
922032912_922032914 -6 Left 922032912 1:221821586-221821608 CCAGAGACTTGTTTGTCTCTTAT No data
Right 922032914 1:221821603-221821625 TCTTATGTAGTGAAGGTACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922032914 Original CRISPR TCTTATGTAGTGAAGGTACC TGG Intergenic
No off target data available for this crispr