ID: 922035969

View in Genome Browser
Species Human (GRCh38)
Location 1:221848474-221848496
Sequence CTGAATTACAAGAAGGAAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922035965_922035969 8 Left 922035965 1:221848443-221848465 CCAGTAGATAGATGACCCACTTG No data
Right 922035969 1:221848474-221848496 CTGAATTACAAGAAGGAAGACGG No data
922035964_922035969 18 Left 922035964 1:221848433-221848455 CCTTCAGAAGCCAGTAGATAGAT No data
Right 922035969 1:221848474-221848496 CTGAATTACAAGAAGGAAGACGG No data
922035966_922035969 -7 Left 922035966 1:221848458-221848480 CCCACTTGTAAAGCAACTGAATT No data
Right 922035969 1:221848474-221848496 CTGAATTACAAGAAGGAAGACGG No data
922035967_922035969 -8 Left 922035967 1:221848459-221848481 CCACTTGTAAAGCAACTGAATTA No data
Right 922035969 1:221848474-221848496 CTGAATTACAAGAAGGAAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922035969 Original CRISPR CTGAATTACAAGAAGGAAGA CGG Intergenic
No off target data available for this crispr