ID: 922038826

View in Genome Browser
Species Human (GRCh38)
Location 1:221875852-221875874
Sequence GAACATTACTACATCCATAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922038823_922038826 25 Left 922038823 1:221875804-221875826 CCTCTTTACATAGGTATGATTCA No data
Right 922038826 1:221875852-221875874 GAACATTACTACATCCATATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922038826 Original CRISPR GAACATTACTACATCCATAT AGG Intergenic
No off target data available for this crispr