ID: 922041650

View in Genome Browser
Species Human (GRCh38)
Location 1:221903671-221903693
Sequence CAGGAAGACCAGCTGCAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922041650_922041657 15 Left 922041650 1:221903671-221903693 CCTCTCTGCAGCTGGTCTTCCTG No data
Right 922041657 1:221903709-221903731 TGGCTCAACCGGGGCTTTTATGG No data
922041650_922041661 26 Left 922041650 1:221903671-221903693 CCTCTCTGCAGCTGGTCTTCCTG No data
Right 922041661 1:221903720-221903742 GGGCTTTTATGGGCCTCAGTGGG No data
922041650_922041658 16 Left 922041650 1:221903671-221903693 CCTCTCTGCAGCTGGTCTTCCTG No data
Right 922041658 1:221903710-221903732 GGCTCAACCGGGGCTTTTATGGG No data
922041650_922041662 27 Left 922041650 1:221903671-221903693 CCTCTCTGCAGCTGGTCTTCCTG No data
Right 922041662 1:221903721-221903743 GGCTTTTATGGGCCTCAGTGGGG No data
922041650_922041656 6 Left 922041650 1:221903671-221903693 CCTCTCTGCAGCTGGTCTTCCTG No data
Right 922041656 1:221903700-221903722 GTCGAGTTCTGGCTCAACCGGGG No data
922041650_922041651 -5 Left 922041650 1:221903671-221903693 CCTCTCTGCAGCTGGTCTTCCTG No data
Right 922041651 1:221903689-221903711 TCCTGTCCTCTGTCGAGTTCTGG No data
922041650_922041660 25 Left 922041650 1:221903671-221903693 CCTCTCTGCAGCTGGTCTTCCTG No data
Right 922041660 1:221903719-221903741 GGGGCTTTTATGGGCCTCAGTGG 0: 35
1: 98
2: 190
3: 205
4: 271
922041650_922041663 30 Left 922041650 1:221903671-221903693 CCTCTCTGCAGCTGGTCTTCCTG No data
Right 922041663 1:221903724-221903746 TTTTATGGGCCTCAGTGGGGAGG No data
922041650_922041655 5 Left 922041650 1:221903671-221903693 CCTCTCTGCAGCTGGTCTTCCTG No data
Right 922041655 1:221903699-221903721 TGTCGAGTTCTGGCTCAACCGGG No data
922041650_922041654 4 Left 922041650 1:221903671-221903693 CCTCTCTGCAGCTGGTCTTCCTG No data
Right 922041654 1:221903698-221903720 CTGTCGAGTTCTGGCTCAACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922041650 Original CRISPR CAGGAAGACCAGCTGCAGAG AGG (reversed) Intergenic
No off target data available for this crispr