ID: 922042582

View in Genome Browser
Species Human (GRCh38)
Location 1:221911195-221911217
Sequence CTCCTTAGGACCCGTGTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922042582_922042588 22 Left 922042582 1:221911195-221911217 CCACAGACACGGGTCCTAAGGAG No data
Right 922042588 1:221911240-221911262 TCCACACATAGAATTCCTCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922042582 Original CRISPR CTCCTTAGGACCCGTGTCTG TGG (reversed) Intergenic
No off target data available for this crispr