ID: 922042588

View in Genome Browser
Species Human (GRCh38)
Location 1:221911240-221911262
Sequence TCCACACATAGAATTCCTCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922042584_922042588 -7 Left 922042584 1:221911224-221911246 CCTTCCTCCTGATCCATCCACAC No data
Right 922042588 1:221911240-221911262 TCCACACATAGAATTCCTCGAGG No data
922042583_922042588 8 Left 922042583 1:221911209-221911231 CCTAAGGAGTCTTAACCTTCCTC No data
Right 922042588 1:221911240-221911262 TCCACACATAGAATTCCTCGAGG No data
922042579_922042588 30 Left 922042579 1:221911187-221911209 CCTAAAGCCCACAGACACGGGTC No data
Right 922042588 1:221911240-221911262 TCCACACATAGAATTCCTCGAGG No data
922042582_922042588 22 Left 922042582 1:221911195-221911217 CCACAGACACGGGTCCTAAGGAG No data
Right 922042588 1:221911240-221911262 TCCACACATAGAATTCCTCGAGG No data
922042581_922042588 23 Left 922042581 1:221911194-221911216 CCCACAGACACGGGTCCTAAGGA No data
Right 922042588 1:221911240-221911262 TCCACACATAGAATTCCTCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922042588 Original CRISPR TCCACACATAGAATTCCTCG AGG Intergenic
No off target data available for this crispr