ID: 922046746

View in Genome Browser
Species Human (GRCh38)
Location 1:221952434-221952456
Sequence CTATTCATATGATGGGAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922046739_922046746 28 Left 922046739 1:221952383-221952405 CCTATGGGAAAAGGGTGATATAA No data
Right 922046746 1:221952434-221952456 CTATTCATATGATGGGAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922046746 Original CRISPR CTATTCATATGATGGGAAAT GGG Intergenic
No off target data available for this crispr