ID: 922053859

View in Genome Browser
Species Human (GRCh38)
Location 1:222021650-222021672
Sequence GAGGCCCATGATGCTGTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922053854_922053859 21 Left 922053854 1:222021606-222021628 CCACAGCAATAACAAACACTTAT No data
Right 922053859 1:222021650-222021672 GAGGCCCATGATGCTGTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922053859 Original CRISPR GAGGCCCATGATGCTGTCAC AGG Intergenic
No off target data available for this crispr