ID: 922056313

View in Genome Browser
Species Human (GRCh38)
Location 1:222045568-222045590
Sequence ATCATCTTAACAAACTCCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922056313_922056318 17 Left 922056313 1:222045568-222045590 CCCCTGGAGTTTGTTAAGATGAT No data
Right 922056318 1:222045608-222045630 GGACCAGATGTAGGCCACGTTGG No data
922056313_922056320 19 Left 922056313 1:222045568-222045590 CCCCTGGAGTTTGTTAAGATGAT No data
Right 922056320 1:222045610-222045632 ACCAGATGTAGGCCACGTTGGGG No data
922056313_922056319 18 Left 922056313 1:222045568-222045590 CCCCTGGAGTTTGTTAAGATGAT No data
Right 922056319 1:222045609-222045631 GACCAGATGTAGGCCACGTTGGG No data
922056313_922056316 -4 Left 922056313 1:222045568-222045590 CCCCTGGAGTTTGTTAAGATGAT No data
Right 922056316 1:222045587-222045609 TGATGCACTCAGAGTGTTCAAGG No data
922056313_922056317 8 Left 922056313 1:222045568-222045590 CCCCTGGAGTTTGTTAAGATGAT No data
Right 922056317 1:222045599-222045621 AGTGTTCAAGGACCAGATGTAGG No data
922056313_922056322 25 Left 922056313 1:222045568-222045590 CCCCTGGAGTTTGTTAAGATGAT No data
Right 922056322 1:222045616-222045638 TGTAGGCCACGTTGGGGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922056313 Original CRISPR ATCATCTTAACAAACTCCAG GGG (reversed) Intergenic
No off target data available for this crispr