ID: 922056315

View in Genome Browser
Species Human (GRCh38)
Location 1:222045570-222045592
Sequence GCATCATCTTAACAAACTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922056315_922056316 -6 Left 922056315 1:222045570-222045592 CCTGGAGTTTGTTAAGATGATGC No data
Right 922056316 1:222045587-222045609 TGATGCACTCAGAGTGTTCAAGG No data
922056315_922056317 6 Left 922056315 1:222045570-222045592 CCTGGAGTTTGTTAAGATGATGC No data
Right 922056317 1:222045599-222045621 AGTGTTCAAGGACCAGATGTAGG No data
922056315_922056320 17 Left 922056315 1:222045570-222045592 CCTGGAGTTTGTTAAGATGATGC No data
Right 922056320 1:222045610-222045632 ACCAGATGTAGGCCACGTTGGGG No data
922056315_922056318 15 Left 922056315 1:222045570-222045592 CCTGGAGTTTGTTAAGATGATGC No data
Right 922056318 1:222045608-222045630 GGACCAGATGTAGGCCACGTTGG No data
922056315_922056325 30 Left 922056315 1:222045570-222045592 CCTGGAGTTTGTTAAGATGATGC No data
Right 922056325 1:222045623-222045645 CACGTTGGGGAGCTGGCATTGGG No data
922056315_922056324 29 Left 922056315 1:222045570-222045592 CCTGGAGTTTGTTAAGATGATGC No data
Right 922056324 1:222045622-222045644 CCACGTTGGGGAGCTGGCATTGG No data
922056315_922056322 23 Left 922056315 1:222045570-222045592 CCTGGAGTTTGTTAAGATGATGC No data
Right 922056322 1:222045616-222045638 TGTAGGCCACGTTGGGGAGCTGG No data
922056315_922056319 16 Left 922056315 1:222045570-222045592 CCTGGAGTTTGTTAAGATGATGC No data
Right 922056319 1:222045609-222045631 GACCAGATGTAGGCCACGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922056315 Original CRISPR GCATCATCTTAACAAACTCC AGG (reversed) Intergenic
No off target data available for this crispr