ID: 922056316

View in Genome Browser
Species Human (GRCh38)
Location 1:222045587-222045609
Sequence TGATGCACTCAGAGTGTTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922056315_922056316 -6 Left 922056315 1:222045570-222045592 CCTGGAGTTTGTTAAGATGATGC No data
Right 922056316 1:222045587-222045609 TGATGCACTCAGAGTGTTCAAGG No data
922056314_922056316 -5 Left 922056314 1:222045569-222045591 CCCTGGAGTTTGTTAAGATGATG No data
Right 922056316 1:222045587-222045609 TGATGCACTCAGAGTGTTCAAGG No data
922056313_922056316 -4 Left 922056313 1:222045568-222045590 CCCCTGGAGTTTGTTAAGATGAT No data
Right 922056316 1:222045587-222045609 TGATGCACTCAGAGTGTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922056316 Original CRISPR TGATGCACTCAGAGTGTTCA AGG Intergenic
No off target data available for this crispr