ID: 922061403

View in Genome Browser
Species Human (GRCh38)
Location 1:222096133-222096155
Sequence GTAAGAGCCTTCTTTGTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922061403_922061405 27 Left 922061403 1:222096133-222096155 CCTGTCACAAAGAAGGCTCTTAC No data
Right 922061405 1:222096183-222096205 TCATGCCCACACATACACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922061403 Original CRISPR GTAAGAGCCTTCTTTGTGAC AGG (reversed) Intergenic
No off target data available for this crispr