ID: 922061404

View in Genome Browser
Species Human (GRCh38)
Location 1:222096155-222096177
Sequence GTGTTCATTATGTGCTACAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922061404_922061410 25 Left 922061404 1:222096155-222096177 CCTATGTAGCACATAATGAACAC No data
Right 922061410 1:222096203-222096225 AGGTGCACACATGCATGCACAGG No data
922061404_922061405 5 Left 922061404 1:222096155-222096177 CCTATGTAGCACATAATGAACAC No data
Right 922061405 1:222096183-222096205 TCATGCCCACACATACACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922061404 Original CRISPR GTGTTCATTATGTGCTACAT AGG (reversed) Intergenic
No off target data available for this crispr